Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:Cntnap2'

202540

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

039841-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46530633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 61 (Y61C)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114639
AA Change: Y61C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110286
Gene: ENSMUSG00000079575
AA Change: Y61C

Domain	Start	End	E-Value	Type
LAG1_DNAbind	34	165	2.3e-90	SMART
BTD	166	315	6e-96	SMART
SCOP:d1a02n1	341	433	9e-29	SMART
low complexity region	469	487	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114641

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182751

Meta Mutation Damage Score

0.9669

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCGCTGTTGCCATAGAACATCTTTAC -3'
(R):5'- CCTATAGGAAGTTTGGTGAGCG -3'

Sequencing Primer
(F):5'- TGCCATAGAACATCTTTACAGACAAC -3'
(R):5'- AAGTTTGGTGAGCGGCCTC -3'

Posted On

2014-06-23