Incidental Mutation 'R1813:Cd8a'
ID 202542
Institutional Source Beutler Lab
Gene Symbol Cd8a
Ensembl Gene ENSMUSG00000053977
Gene Name CD8 subunit alpha
Synonyms Lyt-2, Ly-B, Ly-35, Ly-2
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 71350411-71356155 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 71350947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 137 (M137I)
Ref Sequence ENSEMBL: ENSMUSP00000131873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066747] [ENSMUST00000172321]
AlphaFold P01731
Predicted Effect probably benign
Transcript: ENSMUST00000066747
AA Change: M137I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068123
Gene: ENSMUSG00000053977
AA Change: M137I

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172321
AA Change: M137I

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131873
Gene: ENSMUSG00000053977
AA Change: M137I

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205054
Meta Mutation Damage Score 0.2024 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Bcam A G 7: 19,500,640 (GRCm39) S153P probably damaging Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Htra2 G T 6: 83,028,583 (GRCm39) A318D probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Shisa5 T A 9: 108,885,108 (GRCm39) I126N probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Uso1 A T 5: 92,348,992 (GRCm39) probably null Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r158 C T 7: 22,490,143 (GRCm39) C22Y probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wdr72 G A 9: 74,183,298 (GRCm39) V1077I possibly damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Cd8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cd8a APN 6 71,350,691 (GRCm39) missense probably benign 0.04
IGL02342:Cd8a APN 6 71,350,723 (GRCm39) missense probably damaging 1.00
Alfalfa UTSW 6 71,350,712 (GRCm39) missense probably damaging 0.99
Sprouts UTSW 6 71,350,913 (GRCm39) missense probably damaging 0.97
wenzhou UTSW 6 71,350,856 (GRCm39) missense probably benign 0.02
PIT4618001:Cd8a UTSW 6 71,350,661 (GRCm39) missense possibly damaging 0.94
R0212:Cd8a UTSW 6 71,350,633 (GRCm39) missense probably benign 0.01
R1158:Cd8a UTSW 6 71,350,712 (GRCm39) missense probably damaging 0.99
R4541:Cd8a UTSW 6 71,350,856 (GRCm39) missense probably benign 0.02
R5836:Cd8a UTSW 6 71,350,775 (GRCm39) missense possibly damaging 0.48
R6390:Cd8a UTSW 6 71,350,913 (GRCm39) missense probably damaging 0.97
R6889:Cd8a UTSW 6 71,351,546 (GRCm39) missense probably damaging 1.00
R7773:Cd8a UTSW 6 71,350,799 (GRCm39) missense probably benign 0.01
Z1088:Cd8a UTSW 6 71,350,670 (GRCm39) missense possibly damaging 0.85
Z1177:Cd8a UTSW 6 71,351,577 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCTATATGGCTTCATCCCACAAC -3'
(R):5'- GATCACACGTGCATCCAGAC -3'

Sequencing Primer
(F):5'- TCCCACAACAAGATAACGTGGG -3'
(R):5'- TCCAGGGCGTTTAAAAATCACTTCC -3'
Posted On 2014-06-23