Incidental Mutation 'R1813:Htra2'
ID 202543
Institutional Source Beutler Lab
Gene Symbol Htra2
Ensembl Gene ENSMUSG00000068329
Gene Name HtrA serine peptidase 2
Synonyms HtrA2, OMI, Prss25, mnd2
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1813 (G1)
Quality Score 224
Status Validated
Chromosome 6
Chromosomal Location 83051266-83055273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83051602 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 318 (A318D)
Ref Sequence ENSEMBL: ENSMUSP00000109595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
AlphaFold Q9JIY5
Predicted Effect probably benign
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089645
AA Change: A415D

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329
AA Change: A415D

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113962
AA Change: A318D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329
AA Change: A318D

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113963
AA Change: A383D

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329
AA Change: A383D

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
AA Change: A253D

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329
AA Change: A253D

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Meta Mutation Damage Score 0.2047 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutations of this gene cause progressive parkinsonian symptoms, loss of striatal neurons, spleen and thymus atrophy, failure to thrive, and death before 40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Htra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Htra2 APN 6 83054323 missense probably damaging 1.00
IGL02392:Htra2 APN 6 83054299 missense possibly damaging 0.78
IGL02510:Htra2 APN 6 83051611 missense probably damaging 0.98
IGL03324:Htra2 APN 6 83053756 missense probably damaging 1.00
R4791:Htra2 UTSW 6 83051817 missense probably damaging 1.00
R5185:Htra2 UTSW 6 83054242 missense probably benign 0.14
R5454:Htra2 UTSW 6 83054014 missense probably damaging 0.96
R6364:Htra2 UTSW 6 83053046 missense probably damaging 1.00
R6853:Htra2 UTSW 6 83053831 unclassified probably benign
R7259:Htra2 UTSW 6 83051539 missense possibly damaging 0.81
R7939:Htra2 UTSW 6 83051564 missense probably damaging 1.00
Z1176:Htra2 UTSW 6 83054383 missense probably benign 0.08
Z1177:Htra2 UTSW 6 83053756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAGGGCAAGAGCTTCAC -3'
(R):5'- TTGAACTACAGCTCCGTGAG -3'

Sequencing Primer
(F):5'- AGGGCAAGAGCTTCACACTCTTG -3'
(R):5'- GGTGGATGTATCCTTGAACTT -3'
Posted On 2014-06-23