Incidental Mutation 'R1813:Htra2'
ID 202543
Institutional Source Beutler Lab
Gene Symbol Htra2
Ensembl Gene ENSMUSG00000068329
Gene Name HtrA serine peptidase 2
Synonyms Prss25, HtrA2, mnd2, OMI
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1813 (G1)
Quality Score 224
Status Validated
Chromosome 6
Chromosomal Location 83028247-83031552 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83028583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 318 (A318D)
Ref Sequence ENSEMBL: ENSMUSP00000109595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
AlphaFold Q9JIY5
Predicted Effect probably benign
Transcript: ENSMUST00000000707
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089645
AA Change: A415D

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329
AA Change: A415D

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113962
AA Change: A318D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329
AA Change: A318D

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113963
AA Change: A383D

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329
AA Change: A383D

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
AA Change: A253D

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329
AA Change: A253D

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Meta Mutation Damage Score 0.2047 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutations of this gene cause progressive parkinsonian symptoms, loss of striatal neurons, spleen and thymus atrophy, failure to thrive, and death before 40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Bcam A G 7: 19,500,640 (GRCm39) S153P probably damaging Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Cd8a G T 6: 71,350,947 (GRCm39) M137I possibly damaging Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Shisa5 T A 9: 108,885,108 (GRCm39) I126N probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Uso1 A T 5: 92,348,992 (GRCm39) probably null Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r158 C T 7: 22,490,143 (GRCm39) C22Y probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wdr72 G A 9: 74,183,298 (GRCm39) V1077I possibly damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Htra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Htra2 APN 6 83,031,304 (GRCm39) missense probably damaging 1.00
IGL02392:Htra2 APN 6 83,031,280 (GRCm39) missense possibly damaging 0.78
IGL02510:Htra2 APN 6 83,028,592 (GRCm39) missense probably damaging 0.98
IGL03324:Htra2 APN 6 83,030,737 (GRCm39) missense probably damaging 1.00
R4791:Htra2 UTSW 6 83,028,798 (GRCm39) missense probably damaging 1.00
R5185:Htra2 UTSW 6 83,031,223 (GRCm39) missense probably benign 0.14
R5454:Htra2 UTSW 6 83,030,995 (GRCm39) missense probably damaging 0.96
R6364:Htra2 UTSW 6 83,030,027 (GRCm39) missense probably damaging 1.00
R6853:Htra2 UTSW 6 83,030,812 (GRCm39) unclassified probably benign
R7259:Htra2 UTSW 6 83,028,520 (GRCm39) missense possibly damaging 0.81
R7939:Htra2 UTSW 6 83,028,545 (GRCm39) missense probably damaging 1.00
Z1176:Htra2 UTSW 6 83,031,364 (GRCm39) missense probably benign 0.08
Z1177:Htra2 UTSW 6 83,030,737 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAGGGCAAGAGCTTCAC -3'
(R):5'- TTGAACTACAGCTCCGTGAG -3'

Sequencing Primer
(F):5'- AGGGCAAGAGCTTCACACTCTTG -3'
(R):5'- GGTGGATGTATCCTTGAACTT -3'
Posted On 2014-06-23