Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:A2ml1'

202545

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

MMRRC Submission

039841-MU

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 128566273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 595 (N595Y)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

AlphaFold

Q3UU35

Predicted Effect

probably benign
Transcript: ENSMUST00000060574
AA Change: N595Y

PolyPhen 2 Score 0.343 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: N595Y

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0599:A2ml1	UTSW	6	128552245	missense	probably damaging	1.00
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1536:A2ml1	UTSW	6	128547233	nonsense	probably null
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3615:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5369:A2ml1	UTSW	6	128568833	missense	probably damaging	0.97
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
R8947:A2ml1	UTSW	6	128552256	missense	probably damaging	1.00
R8970:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R9025:A2ml1	UTSW	6	128557582	missense	possibly damaging	0.49
R9083:A2ml1	UTSW	6	128557561	missense	possibly damaging	0.90
R9129:A2ml1	UTSW	6	128546260	missense	probably damaging	1.00
R9145:A2ml1	UTSW	6	128559069	missense	probably benign
R9165:A2ml1	UTSW	6	128560669	missense	probably benign
R9285:A2ml1	UTSW	6	128549793	missense	probably benign
R9408:A2ml1	UTSW	6	128545067	missense	probably damaging	0.98
R9486:A2ml1	UTSW	6	128569979	missense	probably damaging	0.99
R9781:A2ml1	UTSW	6	128542897	missense	probably benign	0.01
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- AACCCATGCTAATAACTGAGAAAGG -3'
(R):5'- GGAGACTGAAAGATATCCCCACAG -3'

Sequencing Primer
(F):5'- GAGCACAGAAGTAAAGACTTGATTC -3'
(R):5'- TACAGAAATCGGTCGGGATTTG -3'

Posted On

2014-06-23