Incidental Mutation 'R1813:Bcam'
ID 202550
Institutional Source Beutler Lab
Gene Symbol Bcam
Ensembl Gene ENSMUSG00000002980
Gene Name basal cell adhesion molecule
Synonyms B-CAM, 1200005K12Rik, Lu
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19490063-19504457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19500640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 153 (S153P)
Ref Sequence ENSEMBL: ENSMUSP00000121145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003061] [ENSMUST00000133427] [ENSMUST00000155244]
AlphaFold Q9R069
Predicted Effect probably damaging
Transcript: ENSMUST00000003061
AA Change: S153P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980
AA Change: S153P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 137 3.1e-9 SMART
IG_like 174 254 1.89e1 SMART
IGc2 275 337 2.58e-6 SMART
IGc2 369 425 2.16e-8 SMART
IG_like 458 523 7.29e-2 SMART
transmembrane domain 541 563 N/A INTRINSIC
low complexity region 601 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133271
Predicted Effect probably benign
Transcript: ENSMUST00000133427
Predicted Effect probably damaging
Transcript: ENSMUST00000155244
AA Change: S153P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121145
Gene: ENSMUSG00000002980
AA Change: S153P

DomainStartEndE-ValueType
IG 32 137 3.1e-9 SMART
Pfam:C2-set_2 143 193 4.3e-12 PFAM
Pfam:Ig_2 145 192 1e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208280
Meta Mutation Damage Score 0.2018 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Cd8a G T 6: 71,350,947 (GRCm39) M137I possibly damaging Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Htra2 G T 6: 83,028,583 (GRCm39) A318D probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Shisa5 T A 9: 108,885,108 (GRCm39) I126N probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Uso1 A T 5: 92,348,992 (GRCm39) probably null Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r158 C T 7: 22,490,143 (GRCm39) C22Y probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wdr72 G A 9: 74,183,298 (GRCm39) V1077I possibly damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Bcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcam APN 7 19,490,724 (GRCm39) missense probably benign 0.02
IGL01433:Bcam APN 7 19,494,107 (GRCm39) missense possibly damaging 0.75
IGL01712:Bcam APN 7 19,492,692 (GRCm39) missense probably damaging 0.99
IGL01943:Bcam APN 7 19,499,423 (GRCm39) missense probably damaging 1.00
IGL01946:Bcam APN 7 19,494,042 (GRCm39) nonsense probably null
IGL02281:Bcam APN 7 19,492,616 (GRCm39) missense probably damaging 1.00
IGL02714:Bcam APN 7 19,492,732 (GRCm39) splice site probably benign
IGL02837:Bcam UTSW 7 19,498,111 (GRCm39) missense probably damaging 1.00
PIT4514001:Bcam UTSW 7 19,497,991 (GRCm39) missense probably benign 0.06
R0063:Bcam UTSW 7 19,500,773 (GRCm39) missense probably benign 0.21
R0063:Bcam UTSW 7 19,500,773 (GRCm39) missense probably benign 0.21
R1500:Bcam UTSW 7 19,492,889 (GRCm39) missense possibly damaging 0.75
R1575:Bcam UTSW 7 19,494,307 (GRCm39) missense possibly damaging 0.87
R1585:Bcam UTSW 7 19,494,111 (GRCm39) missense probably damaging 1.00
R1768:Bcam UTSW 7 19,499,543 (GRCm39) missense probably null 1.00
R1896:Bcam UTSW 7 19,500,640 (GRCm39) missense probably damaging 1.00
R2016:Bcam UTSW 7 19,494,274 (GRCm39) missense probably benign 0.38
R2117:Bcam UTSW 7 19,492,352 (GRCm39) missense possibly damaging 0.71
R3713:Bcam UTSW 7 19,498,118 (GRCm39) missense probably benign 0.12
R3917:Bcam UTSW 7 19,499,375 (GRCm39) missense probably damaging 1.00
R4596:Bcam UTSW 7 19,498,082 (GRCm39) missense probably damaging 0.97
R4866:Bcam UTSW 7 19,499,397 (GRCm39) missense probably benign 0.00
R4874:Bcam UTSW 7 19,503,247 (GRCm39) intron probably benign
R5054:Bcam UTSW 7 19,490,785 (GRCm39) intron probably benign
R5062:Bcam UTSW 7 19,494,026 (GRCm39) missense possibly damaging 0.62
R6783:Bcam UTSW 7 19,500,806 (GRCm39) missense probably damaging 1.00
R6853:Bcam UTSW 7 19,494,331 (GRCm39) missense probably damaging 1.00
R7016:Bcam UTSW 7 19,492,368 (GRCm39) nonsense probably null
R7174:Bcam UTSW 7 19,499,376 (GRCm39) missense probably damaging 1.00
R7237:Bcam UTSW 7 19,503,232 (GRCm39) splice site probably null
R7733:Bcam UTSW 7 19,494,313 (GRCm39) missense probably benign 0.00
R7938:Bcam UTSW 7 19,490,738 (GRCm39) missense probably benign 0.08
R8474:Bcam UTSW 7 19,494,325 (GRCm39) nonsense probably null
R8514:Bcam UTSW 7 19,492,466 (GRCm39) missense probably damaging 1.00
R8880:Bcam UTSW 7 19,492,671 (GRCm39) missense probably damaging 1.00
Z1177:Bcam UTSW 7 19,494,032 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGAAAGTTTCAGGATAGCC -3'
(R):5'- CTGGTGATAGCAAAGGTCCAGG -3'

Sequencing Primer
(F):5'- GCATGCTCAAAGCCCTGAGTTC -3'
(R):5'- ACGGGACTACGTGTGCG -3'
Posted On 2014-06-23