Incidental Mutation 'R1813:Taf5l'
ID 202560
Institutional Source Beutler Lab
Gene Symbol Taf5l
Ensembl Gene ENSMUSG00000038697
Gene Name TATA-box binding protein associated factor 5 like
Synonyms
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123996318-124021397 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124003413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 144 (L144P)
Ref Sequence ENSEMBL: ENSMUSP00000148808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093039] [ENSMUST00000127664] [ENSMUST00000165628] [ENSMUST00000212010]
AlphaFold Q91WQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000093039
AA Change: L179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090726
Gene: ENSMUSG00000038697
AA Change: L179P

DomainStartEndE-ValueType
Pfam:TFIID_NTD2 61 195 8.4e-35 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165628
AA Change: L179P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128710
Gene: ENSMUSG00000038697
AA Change: L179P

DomainStartEndE-ValueType
Pfam:TFIID_90kDa 55 196 1.2e-43 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211825
Predicted Effect probably damaging
Transcript: ENSMUST00000212010
AA Change: L144P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9195 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Taf5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Taf5l APN 8 124003458 missense possibly damaging 0.94
IGL03371:Taf5l APN 8 123997986 missense possibly damaging 0.52
Invalid UTSW 8 124002975 critical splice donor site probably null
R0017:Taf5l UTSW 8 124003644 missense probably damaging 1.00
R1708:Taf5l UTSW 8 124009770 nonsense probably null
R1861:Taf5l UTSW 8 123997990 missense probably damaging 1.00
R1896:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R4570:Taf5l UTSW 8 123997550 missense probably damaging 1.00
R4656:Taf5l UTSW 8 123998105 missense probably benign
R5294:Taf5l UTSW 8 124008218 missense probably benign 0.11
R5335:Taf5l UTSW 8 124003651 missense probably damaging 1.00
R5480:Taf5l UTSW 8 124009820 missense possibly damaging 0.78
R5905:Taf5l UTSW 8 124002975 critical splice donor site probably null
R6028:Taf5l UTSW 8 124002975 critical splice donor site probably null
R7105:Taf5l UTSW 8 124003212 missense probably damaging 1.00
R8304:Taf5l UTSW 8 124003512 missense probably benign 0.03
R8337:Taf5l UTSW 8 123998102 missense probably benign 0.00
R8881:Taf5l UTSW 8 124003362 missense possibly damaging 0.51
R9128:Taf5l UTSW 8 124003275 missense probably benign
R9600:Taf5l UTSW 8 124003434 missense
X0024:Taf5l UTSW 8 123998021 missense probably benign 0.04
Z1088:Taf5l UTSW 8 123997338 nonsense probably null
Z1176:Taf5l UTSW 8 123997362 missense probably benign 0.06
Z1177:Taf5l UTSW 8 124002999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTGACCCGCTTGATAC -3'
(R):5'- CTTCTATAGCCGCTTCCATGGG -3'

Sequencing Primer
(F):5'- GATACTCTCCTGCAAGACTTCCAGG -3'
(R):5'- CCATGGGATGTTCCTGCAGAATG -3'
Posted On 2014-06-23