Incidental Mutation 'R1813:Wdr72'
ID 202564
Institutional Source Beutler Lab
Gene Symbol Wdr72
Ensembl Gene ENSMUSG00000044976
Gene Name WD repeat domain 72
Synonyms
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 74017608-74190485 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74183298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1077 (V1077I)
Ref Sequence ENSEMBL: ENSMUSP00000149349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055879] [ENSMUST00000215440]
AlphaFold D3YYM4
Predicted Effect possibly damaging
Transcript: ENSMUST00000055879
AA Change: V1089I

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057320
Gene: ENSMUSG00000044976
AA Change: V1089I

DomainStartEndE-ValueType
WD40 4 45 1.24e0 SMART
WD40 51 93 1.54e0 SMART
WD40 143 188 8.22e1 SMART
Blast:WD40 319 363 4e-19 BLAST
WD40 398 443 8.88e0 SMART
WD40 461 506 5.97e-1 SMART
WD40 509 554 9.9e0 SMART
WD40 557 596 2.12e-3 SMART
low complexity region 694 711 N/A INTRINSIC
low complexity region 780 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149439
Predicted Effect possibly damaging
Transcript: ENSMUST00000215440
AA Change: V1077I

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display hypomineralized enamel, ameloblast abnormalities and decreased post-weaning body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Bcam A G 7: 19,500,640 (GRCm39) S153P probably damaging Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Cd8a G T 6: 71,350,947 (GRCm39) M137I possibly damaging Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Htra2 G T 6: 83,028,583 (GRCm39) A318D probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Shisa5 T A 9: 108,885,108 (GRCm39) I126N probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Uso1 A T 5: 92,348,992 (GRCm39) probably null Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r158 C T 7: 22,490,143 (GRCm39) C22Y probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Wdr72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Wdr72 APN 9 74,062,411 (GRCm39) missense probably damaging 1.00
IGL01385:Wdr72 APN 9 74,086,788 (GRCm39) splice site probably benign
IGL01512:Wdr72 APN 9 74,056,041 (GRCm39) missense probably benign 0.02
IGL01544:Wdr72 APN 9 74,056,007 (GRCm39) missense probably damaging 1.00
IGL01938:Wdr72 APN 9 74,056,056 (GRCm39) missense probably benign 0.25
IGL02090:Wdr72 APN 9 74,062,212 (GRCm39) missense possibly damaging 0.87
IGL02121:Wdr72 APN 9 74,189,011 (GRCm39) utr 3 prime probably benign
IGL02140:Wdr72 APN 9 74,117,505 (GRCm39) missense probably benign 0.40
IGL02171:Wdr72 APN 9 74,117,816 (GRCm39) missense possibly damaging 0.94
IGL02208:Wdr72 APN 9 74,064,581 (GRCm39) missense probably damaging 1.00
IGL02936:Wdr72 APN 9 74,059,862 (GRCm39) missense probably damaging 1.00
IGL02979:Wdr72 APN 9 74,086,838 (GRCm39) missense probably damaging 1.00
IGL03263:Wdr72 APN 9 74,064,711 (GRCm39) missense probably damaging 1.00
Arresting UTSW 9 74,086,783 (GRCm39) splice site probably benign
R0332_Wdr72_931 UTSW 9 74,064,534 (GRCm39) critical splice acceptor site probably null
R2036_Wdr72_658 UTSW 9 74,058,876 (GRCm39) missense probably damaging 1.00
F5770:Wdr72 UTSW 9 74,064,552 (GRCm39) missense probably damaging 0.96
R0107:Wdr72 UTSW 9 74,117,715 (GRCm39) missense probably damaging 1.00
R0332:Wdr72 UTSW 9 74,064,534 (GRCm39) critical splice acceptor site probably null
R0420:Wdr72 UTSW 9 74,118,039 (GRCm39) missense possibly damaging 0.75
R0536:Wdr72 UTSW 9 74,064,690 (GRCm39) missense probably damaging 1.00
R0565:Wdr72 UTSW 9 74,124,588 (GRCm39) missense probably benign 0.34
R0755:Wdr72 UTSW 9 74,052,376 (GRCm39) missense probably benign 0.05
R1183:Wdr72 UTSW 9 74,086,867 (GRCm39) missense probably benign 0.00
R1636:Wdr72 UTSW 9 74,086,907 (GRCm39) missense probably benign 0.00
R1668:Wdr72 UTSW 9 74,117,444 (GRCm39) missense probably damaging 0.99
R1687:Wdr72 UTSW 9 74,117,481 (GRCm39) missense probably benign 0.13
R1835:Wdr72 UTSW 9 74,058,899 (GRCm39) missense probably damaging 1.00
R2036:Wdr72 UTSW 9 74,058,876 (GRCm39) missense probably damaging 1.00
R2113:Wdr72 UTSW 9 74,052,454 (GRCm39) missense probably benign 0.07
R2331:Wdr72 UTSW 9 74,055,608 (GRCm39) missense probably damaging 1.00
R2369:Wdr72 UTSW 9 74,117,457 (GRCm39) missense possibly damaging 0.77
R3973:Wdr72 UTSW 9 74,125,979 (GRCm39) missense probably benign
R4021:Wdr72 UTSW 9 74,058,875 (GRCm39) missense probably benign 0.18
R4596:Wdr72 UTSW 9 74,058,887 (GRCm39) missense probably benign 0.00
R4665:Wdr72 UTSW 9 74,117,306 (GRCm39) missense probably benign 0.10
R4694:Wdr72 UTSW 9 74,086,837 (GRCm39) missense probably damaging 1.00
R4894:Wdr72 UTSW 9 74,117,843 (GRCm39) missense probably benign 0.00
R5027:Wdr72 UTSW 9 74,053,258 (GRCm39) missense probably damaging 1.00
R5269:Wdr72 UTSW 9 74,064,653 (GRCm39) missense probably damaging 1.00
R5432:Wdr72 UTSW 9 74,183,228 (GRCm39) missense probably damaging 1.00
R5470:Wdr72 UTSW 9 74,046,981 (GRCm39) nonsense probably null
R5717:Wdr72 UTSW 9 74,055,487 (GRCm39) missense probably damaging 1.00
R5793:Wdr72 UTSW 9 74,117,625 (GRCm39) missense probably benign 0.02
R5963:Wdr72 UTSW 9 74,052,310 (GRCm39) missense probably damaging 1.00
R6108:Wdr72 UTSW 9 74,058,950 (GRCm39) missense probably damaging 0.97
R6111:Wdr72 UTSW 9 74,117,607 (GRCm39) missense probably benign 0.00
R6113:Wdr72 UTSW 9 74,059,923 (GRCm39) missense probably benign 0.02
R6245:Wdr72 UTSW 9 74,055,505 (GRCm39) missense probably damaging 1.00
R6469:Wdr72 UTSW 9 74,120,643 (GRCm39) missense probably benign 0.15
R6726:Wdr72 UTSW 9 74,059,822 (GRCm39) missense possibly damaging 0.54
R6857:Wdr72 UTSW 9 74,062,323 (GRCm39) missense probably damaging 1.00
R6916:Wdr72 UTSW 9 74,062,321 (GRCm39) missense probably benign
R6921:Wdr72 UTSW 9 74,117,928 (GRCm39) missense probably benign
R7092:Wdr72 UTSW 9 74,117,754 (GRCm39) missense probably damaging 1.00
R7104:Wdr72 UTSW 9 74,055,597 (GRCm39) missense probably damaging 1.00
R7560:Wdr72 UTSW 9 74,117,408 (GRCm39) missense probably damaging 1.00
R7684:Wdr72 UTSW 9 74,054,292 (GRCm39) missense probably damaging 1.00
R8025:Wdr72 UTSW 9 74,050,781 (GRCm39) missense probably benign 0.00
R8035:Wdr72 UTSW 9 74,086,783 (GRCm39) splice site probably benign
R8079:Wdr72 UTSW 9 74,126,054 (GRCm39) missense probably damaging 0.99
R8142:Wdr72 UTSW 9 74,046,949 (GRCm39) missense probably damaging 1.00
R8166:Wdr72 UTSW 9 74,120,610 (GRCm39) missense probably benign
R8266:Wdr72 UTSW 9 74,050,774 (GRCm39) missense probably damaging 1.00
R8465:Wdr72 UTSW 9 74,059,730 (GRCm39) missense possibly damaging 0.93
R8968:Wdr72 UTSW 9 74,059,729 (GRCm39) missense probably benign 0.31
R9074:Wdr72 UTSW 9 74,125,902 (GRCm39) missense possibly damaging 0.86
R9336:Wdr72 UTSW 9 74,117,292 (GRCm39) missense probably damaging 1.00
R9643:Wdr72 UTSW 9 74,118,041 (GRCm39) missense probably damaging 1.00
V7583:Wdr72 UTSW 9 74,064,552 (GRCm39) missense probably damaging 0.96
X0067:Wdr72 UTSW 9 74,059,784 (GRCm39) missense probably damaging 1.00
Z1177:Wdr72 UTSW 9 74,117,818 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTATCTGTGGGTCTGAACTG -3'
(R):5'- ATGGTGTCAGCTTCCCTTCG -3'

Sequencing Primer
(F):5'- GAACTGGTCTATGATGCTCACTGC -3'
(R):5'- ACCCCAAAGCTGTGTCA -3'
Posted On 2014-06-23