Incidental Mutation 'R1813:Shisa5'
ID 202566
Institutional Source Beutler Lab
Gene Symbol Shisa5
Ensembl Gene ENSMUSG00000025647
Gene Name shisa family member 5
Synonyms 6430628I05Rik, Scotin, 2310008D10Rik
MMRRC Submission 039841-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108867633-108886845 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108885108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000026737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026737] [ENSMUST00000045011] [ENSMUST00000061973] [ENSMUST00000112053] [ENSMUST00000112059] [ENSMUST00000128062] [ENSMUST00000154184] [ENSMUST00000197099] [ENSMUST00000197689] [ENSMUST00000197483] [ENSMUST00000196954] [ENSMUST00000198281] [ENSMUST00000159614] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000198708] [ENSMUST00000198295] [ENSMUST00000198376] [ENSMUST00000200629] [ENSMUST00000200515]
AlphaFold Q9D7I0
Predicted Effect probably damaging
Transcript: ENSMUST00000026737
AA Change: I126N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026737
Gene: ENSMUSG00000025647
AA Change: I126N

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 24 211 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045011
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061973
SMART Domains Protein: ENSMUSP00000050971
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112053
SMART Domains Protein: ENSMUSP00000107684
Gene: ENSMUSG00000049734

DomainStartEndE-ValueType
EXOIII 13 217 2.45e-13 SMART
low complexity region 248 283 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112059
AA Change: I127N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107690
Gene: ENSMUSG00000025647
AA Change: I127N

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Shisa 26 198 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128062
SMART Domains Protein: ENSMUSP00000118499
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
PDB:3MXJ|A 1 150 4e-97 PDB
SCOP:d1fxxa_ 12 146 7e-12 SMART
Blast:EXOIII 13 150 1e-85 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000154184
AA Change: I23N
SMART Domains Protein: ENSMUSP00000128901
Gene: ENSMUSG00000025647
AA Change: I23N

DomainStartEndE-ValueType
Pfam:Shisa 1 108 1.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197194
Predicted Effect possibly damaging
Transcript: ENSMUST00000197099
AA Change: I58N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143648
Gene: ENSMUSG00000025647
AA Change: I58N

DomainStartEndE-ValueType
Pfam:Shisa 1 129 9.9e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197689
AA Change: I24N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142874
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 63 4.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197483
AA Change: I24N

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143613
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196954
AA Change: I24N

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143599
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 95 1.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160928
SMART Domains Protein: ENSMUSP00000123837
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 19 116 9e-3 SMART
low complexity region 249 261 N/A INTRINSIC
low complexity region 465 471 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 521 532 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198281
SMART Domains Protein: ENSMUSP00000143581
Gene: ENSMUSG00000025647

DomainStartEndE-ValueType
Pfam:Shisa 16 74 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159614
SMART Domains Protein: ENSMUSP00000124854
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 54 60 N/A INTRINSIC
low complexity region 67 78 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160217
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161521
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200366
Predicted Effect probably benign
Transcript: ENSMUST00000198708
AA Change: I24N

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142978
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 109 7.8e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199868
AA Change: I27N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000198295
AA Change: I24N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143721
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 70 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198376
AA Change: I24N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143374
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 83 5e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200629
AA Change: I24N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142404
Gene: ENSMUSG00000025647
AA Change: I24N

DomainStartEndE-ValueType
Pfam:Shisa 1 72 1.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200515
AA Change: I62N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142835
Gene: ENSMUSG00000025647
AA Change: I62N

DomainStartEndE-ValueType
Pfam:Shisa 11 147 4.1e-42 PFAM
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the shisa family. The encoded protein is localized to the endoplasmic reticulum, and together with p53 induces apoptosis in a caspase-dependent manner. Alternative splicing results in multiple transcript variants. Related pseudogenes of this gene are found on chromosome X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no apparent phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,543,236 (GRCm39) N595Y probably benign Het
Abca6 A G 11: 110,124,671 (GRCm39) probably benign Het
Abo C A 2: 26,733,609 (GRCm39) D199Y probably damaging Het
Acvr1c A C 2: 58,170,306 (GRCm39) V277G probably damaging Het
Adam23 G A 1: 63,584,731 (GRCm39) A380T probably benign Het
Art2b A G 7: 101,229,236 (GRCm39) V221A probably benign Het
Bcam A G 7: 19,500,640 (GRCm39) S153P probably damaging Het
Brip1 T C 11: 86,077,906 (GRCm39) H174R possibly damaging Het
Ccdc186 T C 19: 56,788,601 (GRCm39) D536G probably benign Het
Cd109 A G 9: 78,524,287 (GRCm39) N67S probably benign Het
Cd8a G T 6: 71,350,947 (GRCm39) M137I possibly damaging Het
Ces2g T C 8: 105,693,569 (GRCm39) F417L probably benign Het
Clec2g A G 6: 128,925,660 (GRCm39) N23S unknown Het
Cntnap2 T C 6: 46,507,567 (GRCm39) Y61C probably damaging Het
Cog3 T A 14: 75,979,784 (GRCm39) E182D probably benign Het
Dbpht2 A G 12: 74,342,624 (GRCm39) noncoding transcript Het
Dock4 A T 12: 40,686,227 (GRCm39) N154I probably damaging Het
Dysf T G 6: 84,128,906 (GRCm39) V1422G possibly damaging Het
E2f3 T C 13: 30,104,159 (GRCm39) D140G probably damaging Het
Efcab3 A G 11: 104,611,514 (GRCm39) K452R probably benign Het
Epb41l2 T A 10: 25,317,466 (GRCm39) probably null Het
Epha2 A G 4: 141,035,857 (GRCm39) K98E possibly damaging Het
Esyt1 T C 10: 128,355,487 (GRCm39) D444G probably benign Het
Fam163a T C 1: 155,955,787 (GRCm39) T2A probably damaging Het
Foxp2 A T 6: 15,379,767 (GRCm39) probably benign Het
Gcm2 T C 13: 41,259,367 (GRCm39) H34R probably benign Het
Gipr A G 7: 18,897,996 (GRCm39) S79P probably benign Het
Gli3 T C 13: 15,823,276 (GRCm39) S333P probably damaging Het
Gm10717 T G 9: 3,026,317 (GRCm39) F205C probably damaging Het
Gzmk A G 13: 113,309,427 (GRCm39) S208P probably damaging Het
Htra2 G T 6: 83,028,583 (GRCm39) A318D probably damaging Het
Itpkc T C 7: 26,907,805 (GRCm39) D633G probably damaging Het
Lama1 G A 17: 68,098,218 (GRCm39) R1805H probably benign Het
Lama4 T A 10: 38,909,121 (GRCm39) probably benign Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Notch3 T C 17: 32,362,402 (GRCm39) T1408A probably benign Het
Nwd2 A G 5: 63,962,753 (GRCm39) D779G probably benign Het
Nxpe4 A G 9: 48,304,678 (GRCm39) Y255C possibly damaging Het
Obox6 A T 7: 15,568,770 (GRCm39) H35Q possibly damaging Het
Or2ab1 A G 11: 58,489,133 (GRCm39) I304V probably damaging Het
Or8b41 T A 9: 38,055,025 (GRCm39) I198N possibly damaging Het
Pkig T A 2: 163,563,147 (GRCm39) I26N possibly damaging Het
Plekhm2 C T 4: 141,369,750 (GRCm39) V82M possibly damaging Het
Plppr2 G A 9: 21,859,220 (GRCm39) A446T probably damaging Het
Psme4 T A 11: 30,754,353 (GRCm39) F203L probably benign Het
Sh3bp1 A G 15: 78,787,880 (GRCm39) K137E probably damaging Het
Slc11a1 T C 1: 74,414,931 (GRCm39) L21P probably benign Het
Slc35f1 C T 10: 52,809,291 (GRCm39) P93S probably damaging Het
Slc4a4 A G 5: 89,194,167 (GRCm39) T172A probably damaging Het
Slc9c1 A T 16: 45,393,710 (GRCm39) Y551F probably benign Het
Spata31 T C 13: 65,069,612 (GRCm39) S587P probably benign Het
Syna C A 5: 134,588,006 (GRCm39) M314I probably benign Het
Taf5l A G 8: 124,730,152 (GRCm39) L144P probably damaging Het
Tbccd1 T C 16: 22,641,271 (GRCm39) T369A probably benign Het
Tnfrsf11b A T 15: 54,119,493 (GRCm39) C160* probably null Het
Trim45 A G 3: 100,830,283 (GRCm39) N19S probably benign Het
Uba2 A G 7: 33,850,455 (GRCm39) F364S probably damaging Het
Unc50 T A 1: 37,476,323 (GRCm39) L161Q probably damaging Het
Uso1 A T 5: 92,348,992 (GRCm39) probably null Het
Usp25 A G 16: 76,911,838 (GRCm39) I956V probably benign Het
Utf1 C A 7: 139,524,213 (GRCm39) L143I probably damaging Het
Vmn1r158 C T 7: 22,490,143 (GRCm39) C22Y probably damaging Het
Vmn1r36 T A 6: 66,693,756 (GRCm39) M40L probably benign Het
Vmn2r43 A G 7: 8,258,055 (GRCm39) V386A possibly damaging Het
Vps9d1 C A 8: 123,973,778 (GRCm39) R335L probably damaging Het
Wasf1 T A 10: 40,802,585 (GRCm39) V80D probably damaging Het
Wdr72 G A 9: 74,183,298 (GRCm39) V1077I possibly damaging Het
Wnt8a A G 18: 34,675,422 (GRCm39) M1V probably null Het
Zbtb26 A G 2: 37,326,347 (GRCm39) S230P possibly damaging Het
Zfp335 A G 2: 164,734,525 (GRCm39) V1247A probably damaging Het
Zfp429 T C 13: 67,538,505 (GRCm39) N313S possibly damaging Het
Zfp74 A T 7: 29,634,569 (GRCm39) C380S probably damaging Het
Zfyve21 G A 12: 111,791,328 (GRCm39) E134K probably damaging Het
Zmynd11 T C 13: 9,739,616 (GRCm39) T474A possibly damaging Het
Other mutations in Shisa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Shisa5 APN 9 108,885,080 (GRCm39) missense probably damaging 1.00
IGL02989:Shisa5 APN 9 108,885,062 (GRCm39) missense probably damaging 1.00
IGL03169:Shisa5 APN 9 108,885,560 (GRCm39) missense probably damaging 1.00
R1809:Shisa5 UTSW 9 108,869,998 (GRCm39) missense probably damaging 0.99
R1896:Shisa5 UTSW 9 108,885,108 (GRCm39) missense probably damaging 0.99
R2516:Shisa5 UTSW 9 108,885,575 (GRCm39) critical splice donor site probably null
R4706:Shisa5 UTSW 9 108,885,128 (GRCm39) missense probably null 0.99
R5800:Shisa5 UTSW 9 108,885,162 (GRCm39) critical splice donor site probably null
R5935:Shisa5 UTSW 9 108,885,751 (GRCm39) missense possibly damaging 0.68
R7299:Shisa5 UTSW 9 108,883,952 (GRCm39) intron probably benign
R7301:Shisa5 UTSW 9 108,883,952 (GRCm39) intron probably benign
R9467:Shisa5 UTSW 9 108,867,712 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCAGCCCTGTTGTATAC -3'
(R):5'- CGCTTAGTCAAAACAGGTTCC -3'

Sequencing Primer
(F):5'- AGCAGCCCTGTTGTATACATGAG -3'
(R):5'- GTCAAAACAGGTTCCTGGTTATC -3'
Posted On 2014-06-23