Incidental Mutation 'R1813:Zmynd11'
ID 202580
Institutional Source Beutler Lab
Gene Symbol Zmynd11
Ensembl Gene ENSMUSG00000021156
Gene Name zinc finger, MYND domain containing 11
Synonyms 2210402G22Rik
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 9684833-9765330 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9689580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 474 (T474A)
Ref Sequence ENSEMBL: ENSMUSP00000106263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062658] [ENSMUST00000110633] [ENSMUST00000110634] [ENSMUST00000110635] [ENSMUST00000110636] [ENSMUST00000110637] [ENSMUST00000110638] [ENSMUST00000130151] [ENSMUST00000222475] [ENSMUST00000223421] [ENSMUST00000157035] [ENSMUST00000220996]
AlphaFold Q8R5C8
Predicted Effect probably benign
Transcript: ENSMUST00000062658
AA Change: T404A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059767
Gene: ENSMUSG00000021156
AA Change: T404A

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110633
AA Change: T474A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106263
Gene: ENSMUSG00000021156
AA Change: T474A

DomainStartEndE-ValueType
PHD 62 106 4.19e-7 SMART
RING 66 105 8.31e-1 SMART
BROMO 111 217 1.03e-18 SMART
PWWP 238 289 1.96e-21 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
coiled coil region 503 543 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110634
AA Change: T458A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106264
Gene: ENSMUSG00000021156
AA Change: T458A

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110635
AA Change: T427A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106265
Gene: ENSMUSG00000021156
AA Change: T427A

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 133 226 3.35e-4 SMART
PWWP 247 298 1.96e-21 SMART
low complexity region 341 354 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
coiled coil region 456 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110636
AA Change: T458A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106266
Gene: ENSMUSG00000021156
AA Change: T458A

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110637
AA Change: T404A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106267
Gene: ENSMUSG00000021156
AA Change: T404A

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110638
AA Change: T460A

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106268
Gene: ENSMUSG00000021156
AA Change: T460A

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
coiled coil region 489 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130151
SMART Domains Protein: ENSMUSP00000118964
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 117 161 4.19e-7 SMART
RING 121 160 8.31e-1 SMART
BROMO 166 272 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138039
Predicted Effect probably benign
Transcript: ENSMUST00000222475
AA Change: T373A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223421
AA Change: T457A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222215
Predicted Effect probably benign
Transcript: ENSMUST00000157035
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222421
Predicted Effect probably benign
Transcript: ENSMUST00000220996
Meta Mutation Damage Score 0.1107 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Other mutations in Zmynd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zmynd11 APN 13 9689226 missense probably damaging 0.97
IGL00846:Zmynd11 APN 13 9720772 critical splice donor site probably null
IGL01606:Zmynd11 APN 13 9697688 missense probably damaging 1.00
IGL03229:Zmynd11 APN 13 9689565 missense probably damaging 1.00
R1173:Zmynd11 UTSW 13 9689549 missense probably damaging 1.00
R1413:Zmynd11 UTSW 13 9710220 missense probably damaging 1.00
R1872:Zmynd11 UTSW 13 9698701 missense possibly damaging 0.88
R2002:Zmynd11 UTSW 13 9689478 splice site probably null
R2991:Zmynd11 UTSW 13 9695822 missense probably damaging 0.99
R4273:Zmynd11 UTSW 13 9697690 missense probably damaging 1.00
R4708:Zmynd11 UTSW 13 9695753 missense probably damaging 0.97
R4718:Zmynd11 UTSW 13 9689567 missense possibly damaging 0.86
R5011:Zmynd11 UTSW 13 9689443 unclassified probably benign
R5151:Zmynd11 UTSW 13 9690917 missense probably damaging 1.00
R5963:Zmynd11 UTSW 13 9695895 intron probably benign
R6648:Zmynd11 UTSW 13 9713021 missense probably benign 0.11
R7002:Zmynd11 UTSW 13 9694330 missense probably damaging 1.00
R7223:Zmynd11 UTSW 13 9710162 missense probably benign 0.09
R7322:Zmynd11 UTSW 13 9690409 missense possibly damaging 0.53
R7462:Zmynd11 UTSW 13 9698684 missense probably benign 0.29
R7500:Zmynd11 UTSW 13 9735398 missense probably benign 0.00
R7737:Zmynd11 UTSW 13 9695139 missense probably damaging 1.00
R8181:Zmynd11 UTSW 13 9689651 missense probably benign 0.08
R8331:Zmynd11 UTSW 13 9695154 missense probably benign 0.21
R8853:Zmynd11 UTSW 13 9690929 missense probably damaging 0.99
R9115:Zmynd11 UTSW 13 9693459 missense probably damaging 1.00
R9184:Zmynd11 UTSW 13 9693439 missense probably benign 0.01
R9747:Zmynd11 UTSW 13 9689208 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAGCTTTGCACTCTCCACC -3'
(R):5'- ACCAGCTTAATTACCTGCTTGG -3'

Sequencing Primer
(F):5'- GCACTCTCCACCGCCCC -3'
(R):5'- CTGAATCAGGGTGAGTTATATTACCC -3'
Posted On 2014-06-23