Incidental Mutation 'R1813:E2f3'
ID202582
Institutional Source Beutler Lab
Gene Symbol E2f3
Ensembl Gene ENSMUSG00000016477
Gene NameE2F transcription factor 3
SynonymsE2F3b, E2f3a
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1813 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location29906575-29986063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29920176 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 140 (D140G)
Ref Sequence ENSEMBL: ENSMUSP00000100012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102948] [ENSMUST00000221536] [ENSMUST00000222730]
Predicted Effect probably damaging
Transcript: ENSMUST00000102948
AA Change: D140G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100012
Gene: ENSMUSG00000016477
AA Change: D140G

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
E2F_TDP 170 235 3.53e-35 SMART
Pfam:E2F_CC-MB 251 344 5.1e-38 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146092
Predicted Effect possibly damaging
Transcript: ENSMUST00000221536
AA Change: D23G

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222730
AA Change: D23G

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lethality prior to adulthood but otherwise appear normal. Mouse embryonic fibroblast cells from mice homozygous for a null allele are defective in cell cycle progression and exhibit reduced proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in E2f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL00774:E2f3 APN 13 29918704 missense probably damaging 1.00
IGL02541:E2f3 APN 13 29916844 critical splice donor site probably null
IGL02669:E2f3 APN 13 29916991 missense probably benign 0.00
IGL03119:E2f3 APN 13 29985365 missense probably benign 0.21
Hillside UTSW 13 29918669 missense probably damaging 1.00
Slippery UTSW 13 29918585 missense possibly damaging 0.94
R0830:E2f3 UTSW 13 29985560 missense probably benign 0.02
R0948:E2f3 UTSW 13 29985533 missense probably damaging 0.99
R1442:E2f3 UTSW 13 29918669 missense probably damaging 1.00
R2496:E2f3 UTSW 13 29911306 missense probably damaging 1.00
R4715:E2f3 UTSW 13 29911275 missense probably damaging 1.00
R5202:E2f3 UTSW 13 29918636 missense probably damaging 1.00
R5902:E2f3 UTSW 13 29985267 unclassified probably benign
R6796:E2f3 UTSW 13 29918585 missense possibly damaging 0.94
R7546:E2f3 UTSW 13 29910129 missense probably damaging 0.98
R7705:E2f3 UTSW 13 29985323 missense probably benign 0.39
R7779:E2f3 UTSW 13 29918615 missense probably damaging 0.99
R8354:E2f3 UTSW 13 29985804 unclassified probably benign
R8518:E2f3 UTSW 13 29913470 missense probably damaging 0.98
R8868:E2f3 UTSW 13 29911318 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCGCCAGAAGAAATTGC -3'
(R):5'- TCCAAGTGTAGGGACGGAATCG -3'

Sequencing Primer
(F):5'- GAAAGAAGTAAAGAAGAAAACATGCC -3'
(R):5'- ACGGAATCGCTGCAGGG -3'
Posted On2014-06-23