Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:E2f3'

202582

Institutional Source

Beutler Lab

Gene Symbol

E2f3

Ensembl Gene

ENSMUSG00000016477

Gene Name

E2F transcription factor 3

Synonyms

E2F3b, E2f3a

MMRRC Submission

039841-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29906575-29986063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29920176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 140 (D140G)

Ref Sequence

ENSEMBL: ENSMUSP00000100012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102948] [ENSMUST00000221536] [ENSMUST00000222730]

AlphaFold

O35261

Predicted Effect

probably damaging
Transcript: ENSMUST00000102948
AA Change: D140G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000100012
Gene: ENSMUSG00000016477
AA Change: D140G

Domain	Start	End	E-Value	Type
low complexity region	16	31	N/A	INTRINSIC
low complexity region	37	51	N/A	INTRINSIC
low complexity region	106	124	N/A	INTRINSIC
low complexity region	155	168	N/A	INTRINSIC
E2F_TDP	170	235	3.53e-35	SMART
Pfam:E2F_CC-MB	251	344	5.1e-38	PFAM
low complexity region	417	430	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146092

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221536
AA Change: D23G

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222730
AA Change: D23G

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.0891

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit increased lethality prior to adulthood but otherwise appear normal. Mouse embryonic fibroblast cells from mice homozygous for a null allele are defective in cell cycle progression and exhibit reduced proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Usp25	A	G	16: 77,114,950	I956V	probably benign	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in E2f3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:E2f3	APN	13	29918704	missense	probably damaging	1.00
IGL00774:E2f3	APN	13	29918704	missense	probably damaging	1.00
IGL02541:E2f3	APN	13	29916844	critical splice donor site	probably null
IGL02669:E2f3	APN	13	29916991	missense	probably benign	0.00
IGL03119:E2f3	APN	13	29985365	missense	probably benign	0.21
Crumble	UTSW	13	29911318	missense	probably damaging	1.00
Hillside	UTSW	13	29918669	missense	probably damaging	1.00
Slippery	UTSW	13	29918585	missense	possibly damaging	0.94
R0830:E2f3	UTSW	13	29985560	missense	probably benign	0.02
R0948:E2f3	UTSW	13	29985533	missense	probably damaging	0.99
R1442:E2f3	UTSW	13	29918669	missense	probably damaging	1.00
R2496:E2f3	UTSW	13	29911306	missense	probably damaging	1.00
R4715:E2f3	UTSW	13	29911275	missense	probably damaging	1.00
R5202:E2f3	UTSW	13	29918636	missense	probably damaging	1.00
R5902:E2f3	UTSW	13	29985267	unclassified	probably benign
R6796:E2f3	UTSW	13	29918585	missense	possibly damaging	0.94
R7546:E2f3	UTSW	13	29910129	missense	probably damaging	0.98
R7705:E2f3	UTSW	13	29985323	missense	probably benign	0.39
R7779:E2f3	UTSW	13	29918615	missense	probably damaging	0.99
R8354:E2f3	UTSW	13	29985804	unclassified	probably benign
R8518:E2f3	UTSW	13	29913470	missense	probably damaging	0.98
R8868:E2f3	UTSW	13	29911318	missense	probably damaging	1.00
R9017:E2f3	UTSW	13	29913495	missense	probably damaging	1.00
R9041:E2f3	UTSW	13	29909956	missense	probably damaging	0.97
R9272:E2f3	UTSW	13	29918646	missense	probably damaging	1.00
R9336:E2f3	UTSW	13	29911256	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TAGGCGCCAGAAGAAATTGC -3'
(R):5'- TCCAAGTGTAGGGACGGAATCG -3'

Sequencing Primer
(F):5'- GAAAGAAGTAAAGAAGAAAACATGCC -3'
(R):5'- ACGGAATCGCTGCAGGG -3'

Posted On

2014-06-23