Incidental Mutation 'R1813:Cog3'
ID202587
Institutional Source Beutler Lab
Gene Symbol Cog3
Ensembl Gene ENSMUSG00000034893
Gene Namecomponent of oligomeric golgi complex 3
Synonyms
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1813 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75702350-75754517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75742344 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 182 (E182D)
Ref Sequence ENSEMBL: ENSMUSP00000045016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049168] [ENSMUST00000227473]
Predicted Effect probably benign
Transcript: ENSMUST00000049168
AA Change: E182D

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045016
Gene: ENSMUSG00000034893
AA Change: E182D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Sec34 130 277 9.5e-57 PFAM
Blast:HisKA 745 810 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226686
Predicted Effect probably benign
Transcript: ENSMUST00000227473
AA Change: E172D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1928 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Cog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Cog3 APN 14 75730604 missense possibly damaging 0.79
IGL02637:Cog3 APN 14 75722196 splice site probably benign
IGL02934:Cog3 APN 14 75741689 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0403:Cog3 UTSW 14 75742327 splice site probably benign
R0972:Cog3 UTSW 14 75717170 missense probably benign
R1735:Cog3 UTSW 14 75729321 nonsense probably null
R1896:Cog3 UTSW 14 75742344 missense probably benign 0.03
R2517:Cog3 UTSW 14 75741742 missense probably benign 0.01
R2567:Cog3 UTSW 14 75754290 missense probably benign
R2962:Cog3 UTSW 14 75740534 critical splice donor site probably null
R3103:Cog3 UTSW 14 75747201 critical splice acceptor site probably null
R3689:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3691:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3927:Cog3 UTSW 14 75743558 splice site probably benign
R4581:Cog3 UTSW 14 75732951 missense probably benign 0.04
R4932:Cog3 UTSW 14 75732954 missense probably damaging 0.98
R5560:Cog3 UTSW 14 75729393 missense probably damaging 1.00
R5654:Cog3 UTSW 14 75724799 missense probably benign 0.03
R6253:Cog3 UTSW 14 75719712 missense probably damaging 1.00
R6419:Cog3 UTSW 14 75724738 nonsense probably null
R6791:Cog3 UTSW 14 75730678 missense probably damaging 1.00
R6803:Cog3 UTSW 14 75704039 missense probably benign 0.00
R7015:Cog3 UTSW 14 75713276 missense possibly damaging 0.81
R7998:Cog3 UTSW 14 75747093 missense possibly damaging 0.94
R7999:Cog3 UTSW 14 75747093 missense possibly damaging 0.94
X0017:Cog3 UTSW 14 75741741 missense probably benign 0.01
X0021:Cog3 UTSW 14 75743593 missense possibly damaging 0.87
X0066:Cog3 UTSW 14 75741741 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAAACAAGGAAGTCTGCCG -3'
(R):5'- AGCAGTGGGTCAGATTTACACC -3'

Sequencing Primer
(F):5'- AAGTCTGCCGGGGCTCTG -3'
(R):5'- GGGGGAAAATATTATTGCCAATCCCC -3'
Posted On2014-06-23