Incidental Mutation 'R1813:Tnfrsf11b'
ID 202588
Institutional Source Beutler Lab
Gene Symbol Tnfrsf11b
Ensembl Gene ENSMUSG00000063727
Gene Name tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin)
Synonyms Opg, OCIF, OPG, TR1, osteoclastogenesis inhibitory factor
MMRRC Submission 039841-MU
Accession Numbers

NCBI RefSeq: NM_008764.3; MGI:109587
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 54250619-54278484 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 54256097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 160 (C160*)
Ref Sequence ENSEMBL: ENSMUSP00000078705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079772]
AlphaFold O08712
PDB Structure Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000079772
AA Change: C160*
SMART Domains Protein: ENSMUSP00000078705
Gene: ENSMUSG00000063727
AA Change: C160*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 24 62 1.04e-2 SMART
TNFR 65 105 1.5e-8 SMART
TNFR 107 142 2.19e-10 SMART
TNFR 145 185 7.63e-1 SMART
DEATH 270 365 1.01e-9 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype Strain: 2181227
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have abnormal bone remodeling that results in severe osteoperosis with increased risk of fractures and growth retardation. Progressive hearing loss also results due to abnormal remodeling of the otic capsule. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Tnfrsf11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tnfrsf11b APN 15 54259842 missense probably damaging 1.00
IGL00770:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL00774:Tnfrsf11b APN 15 54254072 missense probably benign 0.16
IGL02355:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02362:Tnfrsf11b APN 15 54252382 missense probably damaging 0.96
IGL02711:Tnfrsf11b APN 15 54256136 missense probably benign 0.01
IGL02870:Tnfrsf11b APN 15 54256027 missense probably benign 0.05
IGL03219:Tnfrsf11b APN 15 54254178 nonsense probably null
P0012:Tnfrsf11b UTSW 15 54259798 splice site probably benign
R1550:Tnfrsf11b UTSW 15 54254058 missense possibly damaging 0.94
R3840:Tnfrsf11b UTSW 15 54252082 missense probably damaging 0.99
R3910:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3911:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R3912:Tnfrsf11b UTSW 15 54256182 splice site probably benign
R4299:Tnfrsf11b UTSW 15 54252095 missense probably benign
R4362:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R4363:Tnfrsf11b UTSW 15 54256159 missense possibly damaging 0.94
R5288:Tnfrsf11b UTSW 15 54278226 missense probably benign 0.00
R5653:Tnfrsf11b UTSW 15 54259866 missense probably damaging 1.00
R5753:Tnfrsf11b UTSW 15 54254059 missense possibly damaging 0.90
R6881:Tnfrsf11b UTSW 15 54254143 missense probably benign 0.00
R6997:Tnfrsf11b UTSW 15 54252374 missense probably damaging 0.99
R7704:Tnfrsf11b UTSW 15 54260101 missense probably benign 0.30
R7730:Tnfrsf11b UTSW 15 54254074 nonsense probably null
R8017:Tnfrsf11b UTSW 15 54254202 nonsense probably null
R8052:Tnfrsf11b UTSW 15 54252106 missense probably damaging 1.00
R8060:Tnfrsf11b UTSW 15 54254109 missense probably benign 0.38
R8711:Tnfrsf11b UTSW 15 54260112 missense possibly damaging 0.81
R9224:Tnfrsf11b UTSW 15 54252160 missense possibly damaging 0.67
X0025:Tnfrsf11b UTSW 15 54278235 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCTCAGAGAAGGCTATGCTGAG -3'
(R):5'- CGCAACAAACTTGTGTGGG -3'

Sequencing Primer
(F):5'- GCTATGCTGAGATGATAAGAGGAC -3'
(R):5'- CGCAACAAACTTGTGTGGGTATTAC -3'
Posted On 2014-06-23