Incidental Mutation 'R1813:Sh3bp1'
ID202589
Institutional Source Beutler Lab
Gene Symbol Sh3bp1
Ensembl Gene ENSMUSG00000022436
Gene NameSH3-domain binding protein 1
Synonyms3BP-1
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1813 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78899768-78912051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78903680 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 137 (K137E)
Ref Sequence ENSEMBL: ENSMUSP00000154996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000148893] [ENSMUST00000151146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001226
AA Change: K201E

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436
AA Change: K201E

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061239
AA Change: K201E

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436
AA Change: K201E

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109698
AA Change: K201E

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436
AA Change: K201E

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132047
AA Change: K201E

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436
AA Change: K201E

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134703
AA Change: K137E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000148893
SMART Domains Protein: ENSMUSP00000117839
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Blast:BAR 2 55 1e-5 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000151146
AA Change: E175G
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436
AA Change: E175G

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231057
Meta Mutation Damage Score 0.1696 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Sh3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Sh3bp1 APN 15 78905114 missense possibly damaging 0.58
IGL01879:Sh3bp1 APN 15 78907992 missense probably damaging 1.00
IGL02112:Sh3bp1 APN 15 78905884 critical splice donor site probably null
IGL02216:Sh3bp1 APN 15 78905164 missense probably benign 0.07
IGL02385:Sh3bp1 APN 15 78905888 splice site probably benign
IGL02417:Sh3bp1 APN 15 78901499 missense probably damaging 1.00
IGL02551:Sh3bp1 APN 15 78904338 missense probably benign 0.01
PIT1430001:Sh3bp1 UTSW 15 78914024 missense probably benign
PIT4585001:Sh3bp1 UTSW 15 78910076 missense possibly damaging 0.49
R0255:Sh3bp1 UTSW 15 78904334 nonsense probably null
R0318:Sh3bp1 UTSW 15 78911707 missense probably damaging 0.97
R0544:Sh3bp1 UTSW 15 78905775 missense probably damaging 1.00
R0554:Sh3bp1 UTSW 15 78907267 missense probably damaging 1.00
R1424:Sh3bp1 UTSW 15 78903699 critical splice donor site probably null
R1465:Sh3bp1 UTSW 15 78907345 splice site probably benign
R1835:Sh3bp1 UTSW 15 78905150 missense probably damaging 1.00
R2291:Sh3bp1 UTSW 15 78918319 missense possibly damaging 0.93
R2415:Sh3bp1 UTSW 15 78901161 start gained probably benign
R2509:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R2511:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R3054:Sh3bp1 UTSW 15 78911422 missense probably benign 0.01
R3827:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R3855:Sh3bp1 UTSW 15 78901161 start gained probably benign
R4767:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R4787:Sh3bp1 UTSW 15 78907995 missense possibly damaging 0.80
R4852:Sh3bp1 UTSW 15 78904338 missense probably benign 0.01
R4872:Sh3bp1 UTSW 15 78908037 missense probably benign 0.31
R5194:Sh3bp1 UTSW 15 78903101 missense probably damaging 1.00
R6320:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6322:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6569:Sh3bp1 UTSW 15 78911696 missense probably damaging 1.00
R6678:Sh3bp1 UTSW 15 78908514 critical splice donor site probably null
R6905:Sh3bp1 UTSW 15 78905030 missense probably benign 0.00
R7564:Sh3bp1 UTSW 15 78911560 missense probably damaging 1.00
R7744:Sh3bp1 UTSW 15 78910009 missense possibly damaging 0.61
R8048:Sh3bp1 UTSW 15 78910072 missense probably benign 0.26
Z1177:Sh3bp1 UTSW 15 78902572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTGTAAACCCTAGAGTCC -3'
(R):5'- GCACATAAGTACAGCAGAGGTC -3'

Sequencing Primer
(F):5'- AACCCTAGAGTCCTGTGTGATTACG -3'
(R):5'- TACAGCAGAGGTCCTGGG -3'
Posted On2014-06-23