Incidental Mutation 'R1813:Slc9c1'
ID202591
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Namesolute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
SynonymsLOC208169, Slc9a10, spermNHE
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R1813 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45535309-45607001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45573347 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 551 (Y551F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: Y551F

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: Y551F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Usp25 A G 16: 77,114,950 I956V probably benign Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTCTTATAGACAGGGGACAGC -3'
(R):5'- GCAAATGATACCAGATGACCG -3'

Sequencing Primer
(F):5'- GGCTGTGAACTATTTGGCAAC -3'
(R):5'- TGATACCAGATGACCGGGGAG -3'
Posted On2014-06-23