Incidental Mutation 'R1813:Usp25'
ID 202592
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Name ubiquitin specific peptidase 25
Synonyms
MMRRC Submission 039841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1813 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 77013706-77116780 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77114950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 956 (I956V)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
AlphaFold P57080
PDB Structure Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000023580
AA Change: I956V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: I956V

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.8%
  • 20x: 90.3%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,566,273 N595Y probably benign Het
Abca6 A G 11: 110,233,845 probably benign Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
Brip1 T C 11: 86,187,080 H174R possibly damaging Het
Ccdc186 T C 19: 56,800,169 D536G probably benign Het
Cd109 A G 9: 78,617,005 N67S probably benign Het
Cd8a G T 6: 71,373,963 M137I possibly damaging Het
Ces2g T C 8: 104,966,937 F417L probably benign Het
Clec2g A G 6: 128,948,697 N23S unknown Het
Cntnap2 T C 6: 46,530,633 Y61C probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Dbpht2 A G 12: 74,295,850 noncoding transcript Het
Dock4 A T 12: 40,636,228 N154I probably damaging Het
Dysf T G 6: 84,151,924 V1422G possibly damaging Het
E2f3 T C 13: 29,920,176 D140G probably damaging Het
Epb41l2 T A 10: 25,441,568 probably null Het
Epha2 A G 4: 141,308,546 K98E possibly damaging Het
Esyt1 T C 10: 128,519,618 D444G probably benign Het
Fam163a T C 1: 156,080,041 T2A probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Gcm2 T C 13: 41,105,891 H34R probably benign Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gli3 T C 13: 15,648,691 S333P probably damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Htra2 G T 6: 83,051,602 A318D probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lama4 T A 10: 39,033,125 probably benign Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Nxpe4 A G 9: 48,393,378 Y255C possibly damaging Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Olfr324 A G 11: 58,598,307 I304V probably damaging Het
Olfr890 T A 9: 38,143,729 I198N possibly damaging Het
Pkig T A 2: 163,721,227 I26N possibly damaging Het
Plekhm2 C T 4: 141,642,439 V82M possibly damaging Het
Plppr2 G A 9: 21,947,924 A446T probably damaging Het
Psme4 T A 11: 30,804,353 F203L probably benign Het
Sh3bp1 A G 15: 78,903,680 K137E probably damaging Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc35f1 C T 10: 52,933,195 P93S probably damaging Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Slc9c1 A T 16: 45,573,347 Y551F probably benign Het
Spata31 T C 13: 64,921,798 S587P probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tbccd1 T C 16: 22,822,521 T369A probably benign Het
Tnfrsf11b A T 15: 54,256,097 C160* probably null Het
Trim45 A G 3: 100,922,967 N19S probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Uso1 A T 5: 92,201,133 probably null Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Wasf1 T A 10: 40,926,589 V80D probably damaging Het
Wdr72 G A 9: 74,276,016 V1077I possibly damaging Het
Wnt8a A G 18: 34,542,369 M1V probably null Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp335 A G 2: 164,892,605 V1247A probably damaging Het
Zfp429 T C 13: 67,390,386 N313S possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve21 G A 12: 111,824,894 E134K probably damaging Het
Zmynd11 T C 13: 9,689,580 T474A possibly damaging Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 77062405 missense probably damaging 1.00
IGL01359:Usp25 APN 16 77059253 missense probably damaging 1.00
IGL01380:Usp25 APN 16 77093678 missense probably benign 0.06
IGL01614:Usp25 APN 16 77077117 missense probably damaging 1.00
IGL02065:Usp25 APN 16 77083782 missense probably benign 0.06
IGL02271:Usp25 APN 16 77115447 missense probably damaging 1.00
IGL03184:Usp25 APN 16 77081653 missense probably damaging 1.00
IGL03046:Usp25 UTSW 16 77074866 missense probably damaging 1.00
R0433:Usp25 UTSW 16 77109217 missense probably benign 0.02
R0741:Usp25 UTSW 16 77071708 missense possibly damaging 0.80
R0944:Usp25 UTSW 16 77081447 splice site probably benign
R1324:Usp25 UTSW 16 77080387 missense probably damaging 0.98
R1341:Usp25 UTSW 16 77115443 missense probably benign
R1373:Usp25 UTSW 16 77062385 splice site probably benign
R1641:Usp25 UTSW 16 77071671 missense possibly damaging 0.89
R1777:Usp25 UTSW 16 77081554 missense probably damaging 1.00
R1960:Usp25 UTSW 16 77076371 missense probably damaging 1.00
R2256:Usp25 UTSW 16 77113794 missense probably benign
R2271:Usp25 UTSW 16 77076429 missense probably damaging 0.97
R4404:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4408:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4502:Usp25 UTSW 16 77115396 missense probably damaging 1.00
R4604:Usp25 UTSW 16 77115415 missense probably damaging 1.00
R4612:Usp25 UTSW 16 77033945 missense possibly damaging 0.92
R4744:Usp25 UTSW 16 77114989 missense probably damaging 1.00
R4867:Usp25 UTSW 16 77050467 missense probably damaging 1.00
R4932:Usp25 UTSW 16 77033982 critical splice donor site probably null
R5087:Usp25 UTSW 16 77077119 missense probably benign 0.00
R5165:Usp25 UTSW 16 77076405 missense possibly damaging 0.85
R5184:Usp25 UTSW 16 77109227 missense probably benign 0.00
R5307:Usp25 UTSW 16 77093706 missense probably benign
R5331:Usp25 UTSW 16 77050558 missense probably damaging 1.00
R5355:Usp25 UTSW 16 77050454 missense probably damaging 1.00
R5479:Usp25 UTSW 16 77107913 missense possibly damaging 0.51
R5619:Usp25 UTSW 16 77033945 missense probably benign 0.22
R5646:Usp25 UTSW 16 77050472 missense probably benign 0.34
R5946:Usp25 UTSW 16 77115054 nonsense probably null
R6013:Usp25 UTSW 16 77077021 missense probably benign 0.00
R6418:Usp25 UTSW 16 77062442 missense probably damaging 1.00
R6653:Usp25 UTSW 16 77059288 missense probably benign 0.29
R6709:Usp25 UTSW 16 77083932 missense probably benign
R6987:Usp25 UTSW 16 77077180 missense probably damaging 1.00
R7418:Usp25 UTSW 16 77113842 nonsense probably null
R7500:Usp25 UTSW 16 77077201 missense probably damaging 1.00
R7886:Usp25 UTSW 16 77113771 missense probably damaging 0.99
R7961:Usp25 UTSW 16 77059262 missense probably damaging 1.00
R8005:Usp25 UTSW 16 77077068 missense probably benign
R8046:Usp25 UTSW 16 77109175 missense probably damaging 1.00
R8069:Usp25 UTSW 16 77069055 missense possibly damaging 0.58
R8140:Usp25 UTSW 16 77071681 nonsense probably null
R8167:Usp25 UTSW 16 77107931 missense probably damaging 1.00
R8437:Usp25 UTSW 16 77033912 missense probably damaging 1.00
R8704:Usp25 UTSW 16 77059290 missense probably benign 0.00
R8903:Usp25 UTSW 16 77081533 missense probably damaging 1.00
R9123:Usp25 UTSW 16 77115081 critical splice donor site probably null
R9276:Usp25 UTSW 16 77113833 missense probably benign 0.09
R9286:Usp25 UTSW 16 77107976 missense probably damaging 1.00
R9368:Usp25 UTSW 16 77107955 missense probably damaging 1.00
R9489:Usp25 UTSW 16 77077158 missense probably damaging 1.00
R9515:Usp25 UTSW 16 77055188 missense probably damaging 1.00
R9516:Usp25 UTSW 16 77055188 missense probably damaging 1.00
R9580:Usp25 UTSW 16 77083794 missense probably benign 0.00
R9605:Usp25 UTSW 16 77077158 missense probably damaging 1.00
R9667:Usp25 UTSW 16 77077235 critical splice donor site probably null
X0065:Usp25 UTSW 16 77081556 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77071791 missense probably damaging 0.98
Z1176:Usp25 UTSW 16 77071792 missense possibly damaging 0.93
Z1176:Usp25 UTSW 16 77081521 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77083913 missense probably benign
Z1176:Usp25 UTSW 16 77113830 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGCGTTATACCTGATGGCTG -3'
(R):5'- TGACAAAGCCCTCTTCTGC -3'

Sequencing Primer
(F):5'- GTTCTGCTACTCGTTGAACATATTG -3'
(R):5'- AAGCCCTCTTCTGCTGCCG -3'
Posted On 2014-06-23