Mutagenetix > Incidental Mutation

Incidental Mutation 'R1813:Usp25'

202592

Institutional Source

Beutler Lab

Gene Symbol

Usp25

Ensembl Gene

ENSMUSG00000022867

Gene Name

ubiquitin specific peptidase 25

Synonyms

MMRRC Submission

039841-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1813 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77013706-77116780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77114950 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 956 (I956V)

Ref Sequence

ENSEMBL: ENSMUSP00000023580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023580]

AlphaFold

P57080

PDB Structure

Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000023580
AA Change: I956V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: I956V

Domain	Start	End	E-Value	Type
PDB:1VDL\|A	1	67	2e-35	PDB
Blast:UBA	17	56	9e-16	BLAST
UIM	97	116	5.27e-3	SMART
Pfam:UIM	124	140	6.7e-3	PFAM
Pfam:UCH	168	655	9.3e-55	PFAM
Pfam:UCH_1	169	632	3.1e-14	PFAM
coiled coil region	685	714	N/A	INTRINSIC

Meta Mutation Damage Score

0.0640

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.8%
20x: 90.3%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	A	6: 128,566,273	N595Y	probably benign	Het
Abca6	A	G	11: 110,233,845		probably benign	Het
Abo	C	A	2: 26,843,597	D199Y	probably damaging	Het
Acvr1c	A	C	2: 58,280,294	V277G	probably damaging	Het
Adam23	G	A	1: 63,545,572	A380T	probably benign	Het
Art2b	A	G	7: 101,580,029	V221A	probably benign	Het
Bcam	A	G	7: 19,766,715	S153P	probably damaging	Het
Brip1	T	C	11: 86,187,080	H174R	possibly damaging	Het
Ccdc186	T	C	19: 56,800,169	D536G	probably benign	Het
Cd109	A	G	9: 78,617,005	N67S	probably benign	Het
Cd8a	G	T	6: 71,373,963	M137I	possibly damaging	Het
Ces2g	T	C	8: 104,966,937	F417L	probably benign	Het
Clec2g	A	G	6: 128,948,697	N23S	unknown	Het
Cntnap2	T	C	6: 46,530,633	Y61C	probably damaging	Het
Cog3	T	A	14: 75,742,344	E182D	probably benign	Het
Dbpht2	A	G	12: 74,295,850		noncoding transcript	Het
Dock4	A	T	12: 40,636,228	N154I	probably damaging	Het
Dysf	T	G	6: 84,151,924	V1422G	possibly damaging	Het
E2f3	T	C	13: 29,920,176	D140G	probably damaging	Het
Epb41l2	T	A	10: 25,441,568		probably null	Het
Epha2	A	G	4: 141,308,546	K98E	possibly damaging	Het
Esyt1	T	C	10: 128,519,618	D444G	probably benign	Het
Fam163a	T	C	1: 156,080,041	T2A	probably damaging	Het
Foxp2	A	T	6: 15,379,768		probably benign	Het
Gcm2	T	C	13: 41,105,891	H34R	probably benign	Het
Gipr	A	G	7: 19,164,071	S79P	probably benign	Het
Gli3	T	C	13: 15,648,691	S333P	probably damaging	Het
Gm10717	T	G	9: 3,026,317	F205C	probably damaging	Het
Gm11639	A	G	11: 104,720,688	K452R	probably benign	Het
Gzmk	A	G	13: 113,172,893	S208P	probably damaging	Het
Htra2	G	T	6: 83,051,602	A318D	probably damaging	Het
Itpkc	T	C	7: 27,208,380	D633G	probably damaging	Het
Lama1	G	A	17: 67,791,223	R1805H	probably benign	Het
Lama4	T	A	10: 39,033,125		probably benign	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Notch3	T	C	17: 32,143,428	T1408A	probably benign	Het
Nwd2	A	G	5: 63,805,410	D779G	probably benign	Het
Nxpe4	A	G	9: 48,393,378	Y255C	possibly damaging	Het
Obox6	A	T	7: 15,834,845	H35Q	possibly damaging	Het
Olfr324	A	G	11: 58,598,307	I304V	probably damaging	Het
Olfr890	T	A	9: 38,143,729	I198N	possibly damaging	Het
Pkig	T	A	2: 163,721,227	I26N	possibly damaging	Het
Plekhm2	C	T	4: 141,642,439	V82M	possibly damaging	Het
Plppr2	G	A	9: 21,947,924	A446T	probably damaging	Het
Psme4	T	A	11: 30,804,353	F203L	probably benign	Het
Sh3bp1	A	G	15: 78,903,680	K137E	probably damaging	Het
Shisa5	T	A	9: 109,056,040	I126N	probably damaging	Het
Slc11a1	T	C	1: 74,375,772	L21P	probably benign	Het
Slc35f1	C	T	10: 52,933,195	P93S	probably damaging	Het
Slc4a4	A	G	5: 89,046,308	T172A	probably damaging	Het
Slc9c1	A	T	16: 45,573,347	Y551F	probably benign	Het
Spata31	T	C	13: 64,921,798	S587P	probably benign	Het
Syna	C	A	5: 134,559,152	M314I	probably benign	Het
Taf5l	A	G	8: 124,003,413	L144P	probably damaging	Het
Tbccd1	T	C	16: 22,822,521	T369A	probably benign	Het
Tnfrsf11b	A	T	15: 54,256,097	C160*	probably null	Het
Trim45	A	G	3: 100,922,967	N19S	probably benign	Het
Uba2	A	G	7: 34,151,030	F364S	probably damaging	Het
Unc50	T	A	1: 37,437,242	L161Q	probably damaging	Het
Uso1	A	T	5: 92,201,133		probably null	Het
Utf1	C	A	7: 139,944,300	L143I	probably damaging	Het
Vmn1r158	C	T	7: 22,790,718	C22Y	probably damaging	Het
Vmn1r36	T	A	6: 66,716,772	M40L	probably benign	Het
Vmn2r43	A	G	7: 8,255,056	V386A	possibly damaging	Het
Vps9d1	C	A	8: 123,247,039	R335L	probably damaging	Het
Wasf1	T	A	10: 40,926,589	V80D	probably damaging	Het
Wdr72	G	A	9: 74,276,016	V1077I	possibly damaging	Het
Wnt8a	A	G	18: 34,542,369	M1V	probably null	Het
Zbtb26	A	G	2: 37,436,335	S230P	possibly damaging	Het
Zfp335	A	G	2: 164,892,605	V1247A	probably damaging	Het
Zfp429	T	C	13: 67,390,386	N313S	possibly damaging	Het
Zfp74	A	T	7: 29,935,144	C380S	probably damaging	Het
Zfyve21	G	A	12: 111,824,894	E134K	probably damaging	Het
Zmynd11	T	C	13: 9,689,580	T474A	possibly damaging	Het

Other mutations in Usp25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Usp25	APN	16	77062405	missense	probably damaging	1.00
IGL01359:Usp25	APN	16	77059253	missense	probably damaging	1.00
IGL01380:Usp25	APN	16	77093678	missense	probably benign	0.06
IGL01614:Usp25	APN	16	77077117	missense	probably damaging	1.00
IGL02065:Usp25	APN	16	77083782	missense	probably benign	0.06
IGL02271:Usp25	APN	16	77115447	missense	probably damaging	1.00
IGL03184:Usp25	APN	16	77081653	missense	probably damaging	1.00
IGL03046:Usp25	UTSW	16	77074866	missense	probably damaging	1.00
R0433:Usp25	UTSW	16	77109217	missense	probably benign	0.02
R0741:Usp25	UTSW	16	77071708	missense	possibly damaging	0.80
R0944:Usp25	UTSW	16	77081447	splice site	probably benign
R1324:Usp25	UTSW	16	77080387	missense	probably damaging	0.98
R1341:Usp25	UTSW	16	77115443	missense	probably benign
R1373:Usp25	UTSW	16	77062385	splice site	probably benign
R1641:Usp25	UTSW	16	77071671	missense	possibly damaging	0.89
R1777:Usp25	UTSW	16	77081554	missense	probably damaging	1.00
R1960:Usp25	UTSW	16	77076371	missense	probably damaging	1.00
R2256:Usp25	UTSW	16	77113794	missense	probably benign
R2271:Usp25	UTSW	16	77076429	missense	probably damaging	0.97
R4404:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4408:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4502:Usp25	UTSW	16	77115396	missense	probably damaging	1.00
R4604:Usp25	UTSW	16	77115415	missense	probably damaging	1.00
R4612:Usp25	UTSW	16	77033945	missense	possibly damaging	0.92
R4744:Usp25	UTSW	16	77114989	missense	probably damaging	1.00
R4867:Usp25	UTSW	16	77050467	missense	probably damaging	1.00
R4932:Usp25	UTSW	16	77033982	critical splice donor site	probably null
R5087:Usp25	UTSW	16	77077119	missense	probably benign	0.00
R5165:Usp25	UTSW	16	77076405	missense	possibly damaging	0.85
R5184:Usp25	UTSW	16	77109227	missense	probably benign	0.00
R5307:Usp25	UTSW	16	77093706	missense	probably benign
R5331:Usp25	UTSW	16	77050558	missense	probably damaging	1.00
R5355:Usp25	UTSW	16	77050454	missense	probably damaging	1.00
R5479:Usp25	UTSW	16	77107913	missense	possibly damaging	0.51
R5619:Usp25	UTSW	16	77033945	missense	probably benign	0.22
R5646:Usp25	UTSW	16	77050472	missense	probably benign	0.34
R5946:Usp25	UTSW	16	77115054	nonsense	probably null
R6013:Usp25	UTSW	16	77077021	missense	probably benign	0.00
R6418:Usp25	UTSW	16	77062442	missense	probably damaging	1.00
R6653:Usp25	UTSW	16	77059288	missense	probably benign	0.29
R6709:Usp25	UTSW	16	77083932	missense	probably benign
R6987:Usp25	UTSW	16	77077180	missense	probably damaging	1.00
R7418:Usp25	UTSW	16	77113842	nonsense	probably null
R7500:Usp25	UTSW	16	77077201	missense	probably damaging	1.00
R7886:Usp25	UTSW	16	77113771	missense	probably damaging	0.99
R7961:Usp25	UTSW	16	77059262	missense	probably damaging	1.00
R8005:Usp25	UTSW	16	77077068	missense	probably benign
R8046:Usp25	UTSW	16	77109175	missense	probably damaging	1.00
R8069:Usp25	UTSW	16	77069055	missense	possibly damaging	0.58
R8140:Usp25	UTSW	16	77071681	nonsense	probably null
R8167:Usp25	UTSW	16	77107931	missense	probably damaging	1.00
R8437:Usp25	UTSW	16	77033912	missense	probably damaging	1.00
R8704:Usp25	UTSW	16	77059290	missense	probably benign	0.00
R8903:Usp25	UTSW	16	77081533	missense	probably damaging	1.00
R9123:Usp25	UTSW	16	77115081	critical splice donor site	probably null
R9276:Usp25	UTSW	16	77113833	missense	probably benign	0.09
R9286:Usp25	UTSW	16	77107976	missense	probably damaging	1.00
R9368:Usp25	UTSW	16	77107955	missense	probably damaging	1.00
R9489:Usp25	UTSW	16	77077158	missense	probably damaging	1.00
R9515:Usp25	UTSW	16	77055188	missense	probably damaging	1.00
R9516:Usp25	UTSW	16	77055188	missense	probably damaging	1.00
R9580:Usp25	UTSW	16	77083794	missense	probably benign	0.00
R9605:Usp25	UTSW	16	77077158	missense	probably damaging	1.00
R9667:Usp25	UTSW	16	77077235	critical splice donor site	probably null
X0065:Usp25	UTSW	16	77081556	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77071791	missense	probably damaging	0.98
Z1176:Usp25	UTSW	16	77071792	missense	possibly damaging	0.93
Z1176:Usp25	UTSW	16	77081521	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77083913	missense	probably benign
Z1176:Usp25	UTSW	16	77113830	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTAGCGTTATACCTGATGGCTG -3'
(R):5'- TGACAAAGCCCTCTTCTGC -3'

Sequencing Primer
(F):5'- GTTCTGCTACTCGTTGAACATATTG -3'
(R):5'- AAGCCCTCTTCTGCTGCCG -3'

Posted On

2014-06-23