Incidental Mutation 'R1815:Lct'
ID202598
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 039843-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128300159 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1199 (Y1199C)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: Y1199C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: Y1199C

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1932:Lct UTSW 1 128294161 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
R7577:Lct UTSW 1 128300732 missense probably damaging 0.99
R7626:Lct UTSW 1 128285195 missense probably damaging 1.00
R7737:Lct UTSW 1 128298693 missense probably benign 0.12
R7901:Lct UTSW 1 128288985 missense probably benign 0.44
R7984:Lct UTSW 1 128288985 missense probably benign 0.44
R8033:Lct UTSW 1 128285259 missense not run
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Z1176:Lct UTSW 1 128287611 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCAGCAACCTCCTCATC -3'
(R):5'- TCAACACTCACTGGGTCGAAC -3'

Sequencing Primer
(F):5'- ACCTCCTCATCCCCCAGGG -3'
(R):5'- GTCGAACCCAAGGACCCG -3'
Posted On2014-06-23