Incidental Mutation 'R1815:Vps37a'
ID202636
Institutional Source Beutler Lab
Gene Symbol Vps37a
Ensembl Gene ENSMUSG00000031600
Gene Namevacuolar protein sorting 37A
SynonymsD8Ertd531e, 4930592A21Rik, 2210018P21Rik
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R1815 (G1)
Quality Score109
Status Not validated
Chromosome8
Chromosomal Location40511783-40551134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40512121 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 5 (F5L)
Ref Sequence ENSEMBL: ENSMUSP00000096415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000135269] [ENSMUST00000149992]
Predicted Effect probably benign
Transcript: ENSMUST00000034012
SMART Domains Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 15 139 9.1e-15 PFAM
Pfam:CAF1 132 238 1.2e-14 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098817
AA Change: F5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600
AA Change: F5L

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128166
SMART Domains Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
Pfam:zf-DHHC 122 248 1.8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128237
Predicted Effect probably benign
Transcript: ENSMUST00000132032
SMART Domains Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132740
Predicted Effect probably benign
Transcript: ENSMUST00000135269
SMART Domains Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 245 7e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146280
Predicted Effect probably benign
Transcript: ENSMUST00000149992
SMART Domains Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164934
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Vps37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Vps37a APN 8 40540738 missense probably benign 0.00
IGL01963:Vps37a APN 8 40540730 missense probably damaging 0.99
PIT4377001:Vps37a UTSW 8 40537046 missense possibly damaging 0.71
R0090:Vps37a UTSW 8 40526989 missense possibly damaging 0.92
R1106:Vps37a UTSW 8 40512206 missense probably damaging 1.00
R3612:Vps37a UTSW 8 40544936 splice site probably benign
R5775:Vps37a UTSW 8 40529119 missense probably damaging 1.00
R5948:Vps37a UTSW 8 40540711 missense possibly damaging 0.64
R6048:Vps37a UTSW 8 40528322 missense probably damaging 1.00
R6337:Vps37a UTSW 8 40540708 missense probably benign 0.10
R6715:Vps37a UTSW 8 40540861 intron probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGCCTAGCTAACTGAC -3'
(R):5'- CTGGAAGACCCATCAACAGG -3'

Sequencing Primer
(F):5'- TAGCTAACTGACCCCGGG -3'
(R):5'- CACACGGTGTGTTTGCAAGC -3'
Posted On2014-06-23