Incidental Mutation 'R0092:Magi3'
ID 20264
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 038379-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R0092 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 103958280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 602 (Q602*)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000064371
AA Change: Q602*
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: Q602*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121198
AA Change: Q602*
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: Q602*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122303
AA Change: Q602*
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: Q602*

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,662,762 (GRCm39) S535T probably benign Het
Acad11 A T 9: 103,967,540 (GRCm39) probably benign Het
Acadm A T 3: 153,647,512 (GRCm39) probably benign Het
Acot12 T A 13: 91,889,684 (GRCm39) M12K probably damaging Het
Actr2 A T 11: 20,044,308 (GRCm39) N99K probably benign Het
Adam2 G A 14: 66,291,336 (GRCm39) A314V probably damaging Het
Agl C T 3: 116,587,453 (GRCm39) R34Q probably damaging Het
Agrn C T 4: 156,263,410 (GRCm39) R338H probably damaging Het
AI661453 A G 17: 47,778,440 (GRCm39) probably benign Het
Alpk3 A G 7: 80,742,301 (GRCm39) D706G probably benign Het
Apbb1 T C 7: 105,208,361 (GRCm39) E648G probably damaging Het
Astn2 C A 4: 66,322,219 (GRCm39) A127S unknown Het
Asxl2 T C 12: 3,546,313 (GRCm39) S366P probably benign Het
Bdh1 A T 16: 31,266,380 (GRCm39) K92* probably null Het
Bltp1 A G 3: 37,082,308 (GRCm39) D3790G probably benign Het
Cacna1g C T 11: 94,348,090 (GRCm39) S666N probably damaging Het
Ces2b A G 8: 105,563,144 (GRCm39) T361A possibly damaging Het
Col6a4 T A 9: 105,890,513 (GRCm39) E1927V probably benign Het
Ctnnb1 T G 9: 120,781,929 (GRCm39) I314S possibly damaging Het
Cyp2c66 T C 19: 39,172,224 (GRCm39) probably benign Het
Dennd4c T A 4: 86,699,844 (GRCm39) F232I probably damaging Het
Dennd5a T C 7: 109,499,013 (GRCm39) N950S possibly damaging Het
Dhx30 T C 9: 109,914,078 (GRCm39) N14S possibly damaging Het
Dip2b T A 15: 100,100,146 (GRCm39) V1004D probably damaging Het
Dnah1 A C 14: 30,993,566 (GRCm39) S2872A probably benign Het
Dnajc10 T C 2: 80,156,026 (GRCm39) V233A probably damaging Het
E230025N22Rik A G 18: 36,822,277 (GRCm39) L162P probably damaging Het
Elmod3 T C 6: 72,543,792 (GRCm39) D333G probably benign Het
Epb41l3 T A 17: 69,593,745 (GRCm39) M846K probably damaging Het
Frem2 A G 3: 53,497,217 (GRCm39) Y1766H probably benign Het
Fxr2 T C 11: 69,532,972 (GRCm39) probably benign Het
Gmpr2 A G 14: 55,915,402 (GRCm39) R258G probably benign Het
Helb T C 10: 119,925,713 (GRCm39) Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,001,899 (GRCm39) probably null Het
Hipk2 T C 6: 38,720,164 (GRCm39) D482G probably damaging Het
Itgb4 G T 11: 115,869,950 (GRCm39) R44L probably damaging Het
Itih1 T C 14: 30,662,820 (GRCm39) probably benign Het
Kit T A 5: 75,808,414 (GRCm39) S719R possibly damaging Het
Krt13 G A 11: 100,012,258 (GRCm39) Q22* probably null Het
L3mbtl4 A C 17: 68,732,698 (GRCm39) R59S probably benign Het
Lpp A G 16: 24,580,352 (GRCm39) S23G probably benign Het
Man2a1 A G 17: 64,966,079 (GRCm39) probably benign Het
Muc5ac A G 7: 141,372,367 (GRCm39) E2667G possibly damaging Het
Myef2l G A 3: 10,153,633 (GRCm39) C134Y possibly damaging Het
Myo15b C G 11: 115,753,812 (GRCm39) S842C possibly damaging Het
Naf1 T A 8: 67,341,760 (GRCm39) S462T probably benign Het
Necab3 T C 2: 154,400,659 (GRCm39) D34G possibly damaging Het
Nisch C A 14: 30,913,410 (GRCm39) probably benign Het
Nlrc5 T C 8: 95,216,222 (GRCm39) probably benign Het
Nmt1 T C 11: 102,937,319 (GRCm39) F119L probably damaging Het
Nod1 T G 6: 54,921,526 (GRCm39) D264A probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nt5e T A 9: 88,252,338 (GRCm39) F567I probably benign Het
Obscn A T 11: 58,942,073 (GRCm39) M4434K possibly damaging Het
Opa1 A T 16: 29,444,412 (GRCm39) D866V probably damaging Het
Or10a3m T C 7: 108,313,031 (GRCm39) V145A probably benign Het
Or10al3 T G 17: 38,011,696 (GRCm39) L45R probably damaging Het
Or10p1 A G 10: 129,444,090 (GRCm39) S87P probably damaging Het
Or1j21 A G 2: 36,683,508 (GRCm39) T87A probably benign Het
Or51ai2 T C 7: 103,586,934 (GRCm39) S116P probably damaging Het
Otop1 T A 5: 38,457,174 (GRCm39) V311E probably damaging Het
Pcsk2 A G 2: 143,642,944 (GRCm39) D407G probably damaging Het
Pdcd1 A G 1: 93,980,149 (GRCm39) W23R possibly damaging Het
Pigp A G 16: 94,166,321 (GRCm39) V129A probably damaging Het
Pik3r5 A G 11: 68,383,629 (GRCm39) R483G probably benign Het
Pink1 A G 4: 138,047,309 (GRCm39) V225A probably benign Het
Plcl1 C G 1: 55,735,924 (GRCm39) Q422E probably damaging Het
Plec T C 15: 76,067,943 (GRCm39) E1222G probably benign Het
Polr1a T C 6: 71,944,439 (GRCm39) probably benign Het
Prokr2 C T 2: 132,215,517 (GRCm39) V154M probably damaging Het
Rasgrp4 A G 7: 28,844,557 (GRCm39) R280G possibly damaging Het
Rmnd5b T C 11: 51,520,419 (GRCm39) E8G possibly damaging Het
Sbf2 T A 7: 109,920,013 (GRCm39) probably benign Het
Sec23b A G 2: 144,408,830 (GRCm39) M172V probably benign Het
Setx T C 2: 29,036,305 (GRCm39) V930A probably benign Het
Sft2d2 G A 1: 165,006,829 (GRCm39) A159V possibly damaging Het
Sh3gl1 G T 17: 56,325,088 (GRCm39) R250S probably benign Het
Skor1 C A 9: 63,053,277 (GRCm39) D231Y probably damaging Het
Slc24a1 T G 9: 64,856,034 (GRCm39) E291A unknown Het
Slc28a2b G T 2: 122,348,078 (GRCm39) probably benign Het
Smc1b A T 15: 84,951,925 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,644,844 (GRCm39) N177K possibly damaging Het
Tdp1 T A 12: 99,921,248 (GRCm39) Y595N probably damaging Het
Tle5 G A 10: 81,397,054 (GRCm39) G10D possibly damaging Het
Tmem108 T C 9: 103,366,504 (GRCm39) K496E possibly damaging Het
Tmprss7 T C 16: 45,487,959 (GRCm39) D490G probably damaging Het
Tnrc6b A T 15: 80,802,729 (GRCm39) N1511Y probably damaging Het
Top2b G A 14: 16,409,263 (GRCm38) R802Q probably damaging Het
Trip10 A T 17: 57,557,798 (GRCm39) K27N possibly damaging Het
Txlnb A G 10: 17,718,503 (GRCm39) N445D possibly damaging Het
Txnrd1 T A 10: 82,715,636 (GRCm39) I159N probably damaging Het
Ulk1 C A 5: 110,944,193 (GRCm39) A164S probably null Het
Vmn2r83 T C 10: 79,327,798 (GRCm39) V802A probably damaging Het
Zbtb4 A G 11: 69,670,177 (GRCm39) I967V probably benign Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R6897:Magi3 UTSW 3 103,996,873 (GRCm39) missense probably damaging 1.00
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7709:Magi3 UTSW 3 103,941,354 (GRCm39) missense probably damaging 1.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R7950:Magi3 UTSW 3 103,924,005 (GRCm39) missense probably damaging 1.00
R8140:Magi3 UTSW 3 103,941,402 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8892:Magi3 UTSW 3 103,958,141 (GRCm39) missense probably damaging 1.00
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9697:Magi3 UTSW 3 103,956,458 (GRCm39) critical splice donor site probably null
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACATCTGCACCTACTGGGAAC -3'
(R):5'- CTGCTACCCCTGTCATCAATGGAC -3'

Sequencing Primer
(F):5'- CCTACTGGGAACTGCTTTAGGAC -3'
(R):5'- CTCAGGATTTTAAACTGGGAGC -3'
Posted On 2013-04-11