Incidental Mutation 'Y5409:Zfp24'
ID202687
Institutional Source Beutler Lab
Gene Symbol Zfp24
Ensembl Gene ENSMUSG00000051469
Gene Namezinc finger protein 24
SynonymsZF-12, Zfp191, KOX17, 3526401F17Rik, 5033419P20Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #Y5409 ()
Quality Score90
Status Not validated
Chromosome18
Chromosomal Location24009702-24020810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24017855 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 78 (R78H)
Ref Sequence ENSEMBL: ENSMUSP00000122579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066497] [ENSMUST00000148525] [ENSMUST00000153337]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066497
AA Change: R78H

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064637
Gene: ENSMUSG00000051469
AA Change: R78H

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148525
Predicted Effect possibly damaging
Transcript: ENSMUST00000153337
AA Change: R78H

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122579
Gene: ENSMUSG00000051469
AA Change: R78H

DomainStartEndE-ValueType
SCAN 48 160 1.75e-73 SMART
ZnF_C2H2 251 273 3.63e-3 SMART
ZnF_C2H2 279 301 5.06e-2 SMART
ZnF_C2H2 307 329 9.08e-4 SMART
ZnF_C2H2 335 357 2.4e-3 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous null for one mutation have hypomyelination of the central nervous system, tremors, tonic seizures and premature death, whereas mice homozygous null for another mutation are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap36 A G X: 49,495,433 N159D probably benign Het
Rhot2 G A 17: 25,844,295 S19F probably damaging Het
Other mutations in Zfp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02750:Zfp24 APN 18 24017353 missense possibly damaging 0.48
R1573:Zfp24 UTSW 18 24017342 missense possibly damaging 0.70
R1946:Zfp24 UTSW 18 24014419 frame shift probably null
R2508:Zfp24 UTSW 18 24017870 missense probably damaging 1.00
R2845:Zfp24 UTSW 18 24017828 missense probably damaging 0.99
R4119:Zfp24 UTSW 18 24014569 missense possibly damaging 0.86
R4471:Zfp24 UTSW 18 24018115 start gained probably benign
R5847:Zfp24 UTSW 18 24018038 missense possibly damaging 0.93
R6091:Zfp24 UTSW 18 24014212 missense probably damaging 1.00
R6659:Zfp24 UTSW 18 24017334 missense possibly damaging 0.61
Y4338:Zfp24 UTSW 18 24017855 missense possibly damaging 0.55
Y4338:Zfp24 UTSW 18 24017868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTCATCAAGCTCACTCTC -3'
(R):5'- TGCACAGTCAGTGGAAGAAGATTC -3'

Sequencing Primer
(F):5'- AAGCTCACTCTCCAAGTCCTCTAG -3'
(R):5'- CAGTCAGTGGAAGAAGATTCAATAC -3'
Posted On2014-06-23