Incidental Mutation 'Y5379:Ncbp3'
ID202694
Institutional Source Beutler Lab
Gene Symbol Ncbp3
Ensembl Gene ENSMUSG00000020783
Gene Namenuclear cap binding subunit 3
Synonyms1200014J11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #Y5379 ()
Quality Score108
Status Not validated
Chromosome11
Chromosomal Location73047783-73089317 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA at 73073260 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021135]
Predicted Effect probably benign
Transcript: ENSMUST00000021135
SMART Domains Protein: ENSMUSP00000021135
Gene: ENSMUSG00000020783

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 33 52 N/A INTRINSIC
Pfam:DUF2414 123 177 4.5e-24 PFAM
low complexity region 191 231 N/A INTRINSIC
coiled coil region 345 364 N/A INTRINSIC
low complexity region 379 403 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 602 615 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 1 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Other mutations in Ncbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ncbp3 APN 11 73073529 splice site probably benign
R0180:Ncbp3 UTSW 11 73064978 splice site probably null
R0464:Ncbp3 UTSW 11 73069821 splice site probably benign
R0620:Ncbp3 UTSW 11 73049845 splice site probably benign
R2024:Ncbp3 UTSW 11 73053520 missense possibly damaging 0.95
R2121:Ncbp3 UTSW 11 73053478 missense possibly damaging 0.56
R4610:Ncbp3 UTSW 11 73079018 missense probably damaging 0.98
R4693:Ncbp3 UTSW 11 73075677 missense probably benign 0.00
R4883:Ncbp3 UTSW 11 73069752 missense probably damaging 0.99
R4974:Ncbp3 UTSW 11 73053529 critical splice donor site probably null
R5212:Ncbp3 UTSW 11 73053547 intron probably benign
R5740:Ncbp3 UTSW 11 73053497 missense possibly damaging 0.88
R5906:Ncbp3 UTSW 11 73073501 missense probably benign 0.04
R6026:Ncbp3 UTSW 11 73067722 missense probably benign 0.00
R6154:Ncbp3 UTSW 11 73049874 missense probably damaging 1.00
R6403:Ncbp3 UTSW 11 73078976 missense probably benign 0.00
R6626:Ncbp3 UTSW 11 73073384 missense possibly damaging 0.88
R6838:Ncbp3 UTSW 11 73073474 missense possibly damaging 0.89
R7155:Ncbp3 UTSW 11 73048009 missense probably damaging 0.99
R7369:Ncbp3 UTSW 11 73077921 missense probably benign 0.00
R7587:Ncbp3 UTSW 11 73066765 splice site probably null
R7657:Ncbp3 UTSW 11 73073367 missense probably damaging 1.00
Z1177:Ncbp3 UTSW 11 73047968 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAAGATGGCGTCCAGGTGAC -3'
(R):5'- CTGCATACATGGTCATTTTCATGC -3'

Sequencing Primer
(F):5'- GTGACACTTGTAGGCAGCACTATC -3'
(R):5'- GGGAGTAGAAATCATCTTCAGTTCC -3'
Posted On2014-06-23