Incidental Mutation 'R0092:Otop1'
ID 20270
Institutional Source Beutler Lab
Gene Symbol Otop1
Ensembl Gene ENSMUSG00000051596
Gene Name otopetrin 1
Synonyms tlt, A530025J20Rik
MMRRC Submission 038379-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R0092 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 38434748-38461560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38457174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 311 (V311E)
Ref Sequence ENSEMBL: ENSMUSP00000109734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063136] [ENSMUST00000114099]
AlphaFold Q80VM9
Predicted Effect probably damaging
Transcript: ENSMUST00000063136
AA Change: V308E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061805
Gene: ENSMUSG00000051596
AA Change: V308E

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 87 106 N/A INTRINSIC
Pfam:Otopetrin 127 239 1.6e-13 PFAM
Pfam:Otopetrin 240 456 1.9e-16 PFAM
low complexity region 462 471 N/A INTRINSIC
Pfam:Otopetrin 518 583 3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114099
AA Change: V311E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109734
Gene: ENSMUSG00000051596
AA Change: V311E

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
Pfam:Otopetrin 130 457 3.1e-40 PFAM
low complexity region 466 475 N/A INTRINSIC
Pfam:Otopetrin 513 587 2.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187863
Meta Mutation Damage Score 0.4333 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype PHENOTYPE: Homozygous mutant mice display vestibular abnormalities associated with absent otoconia. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Spontaneous(1) Chemically induced(2)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,662,762 (GRCm39) S535T probably benign Het
Acad11 A T 9: 103,967,540 (GRCm39) probably benign Het
Acadm A T 3: 153,647,512 (GRCm39) probably benign Het
Acot12 T A 13: 91,889,684 (GRCm39) M12K probably damaging Het
Actr2 A T 11: 20,044,308 (GRCm39) N99K probably benign Het
Adam2 G A 14: 66,291,336 (GRCm39) A314V probably damaging Het
Agl C T 3: 116,587,453 (GRCm39) R34Q probably damaging Het
Agrn C T 4: 156,263,410 (GRCm39) R338H probably damaging Het
AI661453 A G 17: 47,778,440 (GRCm39) probably benign Het
Alpk3 A G 7: 80,742,301 (GRCm39) D706G probably benign Het
Apbb1 T C 7: 105,208,361 (GRCm39) E648G probably damaging Het
Astn2 C A 4: 66,322,219 (GRCm39) A127S unknown Het
Asxl2 T C 12: 3,546,313 (GRCm39) S366P probably benign Het
Bdh1 A T 16: 31,266,380 (GRCm39) K92* probably null Het
Bltp1 A G 3: 37,082,308 (GRCm39) D3790G probably benign Het
Cacna1g C T 11: 94,348,090 (GRCm39) S666N probably damaging Het
Ces2b A G 8: 105,563,144 (GRCm39) T361A possibly damaging Het
Col6a4 T A 9: 105,890,513 (GRCm39) E1927V probably benign Het
Ctnnb1 T G 9: 120,781,929 (GRCm39) I314S possibly damaging Het
Cyp2c66 T C 19: 39,172,224 (GRCm39) probably benign Het
Dennd4c T A 4: 86,699,844 (GRCm39) F232I probably damaging Het
Dennd5a T C 7: 109,499,013 (GRCm39) N950S possibly damaging Het
Dhx30 T C 9: 109,914,078 (GRCm39) N14S possibly damaging Het
Dip2b T A 15: 100,100,146 (GRCm39) V1004D probably damaging Het
Dnah1 A C 14: 30,993,566 (GRCm39) S2872A probably benign Het
Dnajc10 T C 2: 80,156,026 (GRCm39) V233A probably damaging Het
E230025N22Rik A G 18: 36,822,277 (GRCm39) L162P probably damaging Het
Elmod3 T C 6: 72,543,792 (GRCm39) D333G probably benign Het
Epb41l3 T A 17: 69,593,745 (GRCm39) M846K probably damaging Het
Frem2 A G 3: 53,497,217 (GRCm39) Y1766H probably benign Het
Fxr2 T C 11: 69,532,972 (GRCm39) probably benign Het
Gmpr2 A G 14: 55,915,402 (GRCm39) R258G probably benign Het
Helb T C 10: 119,925,713 (GRCm39) Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,001,899 (GRCm39) probably null Het
Hipk2 T C 6: 38,720,164 (GRCm39) D482G probably damaging Het
Itgb4 G T 11: 115,869,950 (GRCm39) R44L probably damaging Het
Itih1 T C 14: 30,662,820 (GRCm39) probably benign Het
Kit T A 5: 75,808,414 (GRCm39) S719R possibly damaging Het
Krt13 G A 11: 100,012,258 (GRCm39) Q22* probably null Het
L3mbtl4 A C 17: 68,732,698 (GRCm39) R59S probably benign Het
Lpp A G 16: 24,580,352 (GRCm39) S23G probably benign Het
Magi3 G A 3: 103,958,280 (GRCm39) Q602* probably null Het
Man2a1 A G 17: 64,966,079 (GRCm39) probably benign Het
Muc5ac A G 7: 141,372,367 (GRCm39) E2667G possibly damaging Het
Myef2l G A 3: 10,153,633 (GRCm39) C134Y possibly damaging Het
Myo15b C G 11: 115,753,812 (GRCm39) S842C possibly damaging Het
Naf1 T A 8: 67,341,760 (GRCm39) S462T probably benign Het
Necab3 T C 2: 154,400,659 (GRCm39) D34G possibly damaging Het
Nisch C A 14: 30,913,410 (GRCm39) probably benign Het
Nlrc5 T C 8: 95,216,222 (GRCm39) probably benign Het
Nmt1 T C 11: 102,937,319 (GRCm39) F119L probably damaging Het
Nod1 T G 6: 54,921,526 (GRCm39) D264A probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nt5e T A 9: 88,252,338 (GRCm39) F567I probably benign Het
Obscn A T 11: 58,942,073 (GRCm39) M4434K possibly damaging Het
Opa1 A T 16: 29,444,412 (GRCm39) D866V probably damaging Het
Or10a3m T C 7: 108,313,031 (GRCm39) V145A probably benign Het
Or10al3 T G 17: 38,011,696 (GRCm39) L45R probably damaging Het
Or10p1 A G 10: 129,444,090 (GRCm39) S87P probably damaging Het
Or1j21 A G 2: 36,683,508 (GRCm39) T87A probably benign Het
Or51ai2 T C 7: 103,586,934 (GRCm39) S116P probably damaging Het
Pcsk2 A G 2: 143,642,944 (GRCm39) D407G probably damaging Het
Pdcd1 A G 1: 93,980,149 (GRCm39) W23R possibly damaging Het
Pigp A G 16: 94,166,321 (GRCm39) V129A probably damaging Het
Pik3r5 A G 11: 68,383,629 (GRCm39) R483G probably benign Het
Pink1 A G 4: 138,047,309 (GRCm39) V225A probably benign Het
Plcl1 C G 1: 55,735,924 (GRCm39) Q422E probably damaging Het
Plec T C 15: 76,067,943 (GRCm39) E1222G probably benign Het
Polr1a T C 6: 71,944,439 (GRCm39) probably benign Het
Prokr2 C T 2: 132,215,517 (GRCm39) V154M probably damaging Het
Rasgrp4 A G 7: 28,844,557 (GRCm39) R280G possibly damaging Het
Rmnd5b T C 11: 51,520,419 (GRCm39) E8G possibly damaging Het
Sbf2 T A 7: 109,920,013 (GRCm39) probably benign Het
Sec23b A G 2: 144,408,830 (GRCm39) M172V probably benign Het
Setx T C 2: 29,036,305 (GRCm39) V930A probably benign Het
Sft2d2 G A 1: 165,006,829 (GRCm39) A159V possibly damaging Het
Sh3gl1 G T 17: 56,325,088 (GRCm39) R250S probably benign Het
Skor1 C A 9: 63,053,277 (GRCm39) D231Y probably damaging Het
Slc24a1 T G 9: 64,856,034 (GRCm39) E291A unknown Het
Slc28a2b G T 2: 122,348,078 (GRCm39) probably benign Het
Smc1b A T 15: 84,951,925 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,644,844 (GRCm39) N177K possibly damaging Het
Tdp1 T A 12: 99,921,248 (GRCm39) Y595N probably damaging Het
Tle5 G A 10: 81,397,054 (GRCm39) G10D possibly damaging Het
Tmem108 T C 9: 103,366,504 (GRCm39) K496E possibly damaging Het
Tmprss7 T C 16: 45,487,959 (GRCm39) D490G probably damaging Het
Tnrc6b A T 15: 80,802,729 (GRCm39) N1511Y probably damaging Het
Top2b G A 14: 16,409,263 (GRCm38) R802Q probably damaging Het
Trip10 A T 17: 57,557,798 (GRCm39) K27N possibly damaging Het
Txlnb A G 10: 17,718,503 (GRCm39) N445D possibly damaging Het
Txnrd1 T A 10: 82,715,636 (GRCm39) I159N probably damaging Het
Ulk1 C A 5: 110,944,193 (GRCm39) A164S probably null Het
Vmn2r83 T C 10: 79,327,798 (GRCm39) V802A probably damaging Het
Zbtb4 A G 11: 69,670,177 (GRCm39) I967V probably benign Het
Other mutations in Otop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Otop1 APN 5 38,460,188 (GRCm39) missense probably damaging 1.00
IGL01793:Otop1 APN 5 38,457,215 (GRCm39) missense possibly damaging 0.89
IGL02071:Otop1 APN 5 38,445,327 (GRCm39) missense probably damaging 1.00
IGL02111:Otop1 APN 5 38,435,045 (GRCm39) missense probably benign 0.01
IGL02660:Otop1 APN 5 38,445,349 (GRCm39) missense probably damaging 0.99
IGL02672:Otop1 APN 5 38,435,170 (GRCm39) critical splice donor site probably null
IGL03164:Otop1 APN 5 38,445,306 (GRCm39) nonsense probably null
BB008:Otop1 UTSW 5 38,445,364 (GRCm39) missense probably damaging 1.00
BB018:Otop1 UTSW 5 38,445,364 (GRCm39) missense probably damaging 1.00
P0015:Otop1 UTSW 5 38,451,903 (GRCm39) splice site probably benign
R0639:Otop1 UTSW 5 38,445,292 (GRCm39) missense possibly damaging 0.77
R0670:Otop1 UTSW 5 38,445,292 (GRCm39) missense possibly damaging 0.77
R0673:Otop1 UTSW 5 38,445,292 (GRCm39) missense possibly damaging 0.77
R2092:Otop1 UTSW 5 38,457,110 (GRCm39) missense probably damaging 1.00
R2105:Otop1 UTSW 5 38,457,801 (GRCm39) missense probably benign
R2152:Otop1 UTSW 5 38,460,194 (GRCm39) missense probably damaging 1.00
R3971:Otop1 UTSW 5 38,457,533 (GRCm39) missense probably benign 0.04
R3972:Otop1 UTSW 5 38,457,533 (GRCm39) missense probably benign 0.04
R4575:Otop1 UTSW 5 38,457,065 (GRCm39) missense probably damaging 1.00
R4660:Otop1 UTSW 5 38,457,368 (GRCm39) missense possibly damaging 0.95
R4998:Otop1 UTSW 5 38,451,892 (GRCm39) critical splice donor site probably null
R5412:Otop1 UTSW 5 38,455,328 (GRCm39) missense probably benign 0.25
R5461:Otop1 UTSW 5 38,457,059 (GRCm39) missense probably damaging 1.00
R5607:Otop1 UTSW 5 38,451,848 (GRCm39) missense possibly damaging 0.68
R5625:Otop1 UTSW 5 38,460,104 (GRCm39) missense probably damaging 1.00
R5677:Otop1 UTSW 5 38,457,507 (GRCm39) missense probably damaging 1.00
R5792:Otop1 UTSW 5 38,455,260 (GRCm39) missense probably benign 0.04
R5878:Otop1 UTSW 5 38,435,166 (GRCm39) missense possibly damaging 0.73
R6163:Otop1 UTSW 5 38,445,234 (GRCm39) splice site probably null
R7338:Otop1 UTSW 5 38,457,547 (GRCm39) nonsense probably null
R7931:Otop1 UTSW 5 38,445,364 (GRCm39) missense probably damaging 1.00
R7994:Otop1 UTSW 5 38,457,195 (GRCm39) missense probably benign 0.02
R8224:Otop1 UTSW 5 38,457,846 (GRCm39) missense possibly damaging 0.79
R8733:Otop1 UTSW 5 38,457,796 (GRCm39) nonsense probably null
R8733:Otop1 UTSW 5 38,457,117 (GRCm39) missense probably damaging 1.00
R8987:Otop1 UTSW 5 38,457,071 (GRCm39) missense probably damaging 1.00
R9192:Otop1 UTSW 5 38,445,274 (GRCm39) missense probably benign 0.25
R9278:Otop1 UTSW 5 38,460,158 (GRCm39) missense probably damaging 1.00
R9290:Otop1 UTSW 5 38,455,302 (GRCm39) missense probably benign 0.06
X0064:Otop1 UTSW 5 38,457,095 (GRCm39) missense probably damaging 1.00
Z1177:Otop1 UTSW 5 38,435,114 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCACTGCCCTAGTTTTGGATGAC -3'
(R):5'- CTGTAAATCCAGCTTCCGACTAGCC -3'

Sequencing Primer
(F):5'- CTAGTTTTGGATGACCACACAC -3'
(R):5'- TTCCGACTAGCCCTGCG -3'
Posted On 2013-04-11