Incidental Mutation 'R1574:Kcng1'
ID202705
Institutional Source Beutler Lab
Gene Symbol Kcng1
Ensembl Gene ENSMUSG00000074575
Gene Namepotassium voltage-gated channel, subfamily G, member 1
SynonymsOTTMUSG00000016048
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168260117-168281736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 168269041 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 68 (N68Y)
Ref Sequence ENSEMBL: ENSMUSP00000104815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099069] [ENSMUST00000109191] [ENSMUST00000131749]
Predicted Effect probably damaging
Transcript: ENSMUST00000099069
AA Change: N68Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096668
Gene: ENSMUSG00000074575
AA Change: N68Y

DomainStartEndE-ValueType
BTB 63 172 4.22e-5 SMART
low complexity region 174 197 N/A INTRINSIC
Pfam:Ion_trans 226 470 8.6e-41 PFAM
Pfam:Ion_trans_2 379 465 7.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109191
AA Change: N68Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104815
Gene: ENSMUSG00000074575
AA Change: N68Y

DomainStartEndE-ValueType
BTB 63 172 4.22e-5 SMART
low complexity region 174 197 N/A INTRINSIC
Pfam:Ion_trans 270 459 1.9e-31 PFAM
Pfam:Ion_trans_2 379 465 1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131749
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This gene is abundantly expressed in skeletal muscle. Multiple alternatively spliced transcript variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apeh A T 9: 108,092,726 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cdc25b T A 2: 131,191,137 probably benign Het
Cdon A G 9: 35,452,937 probably benign Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Ddx19a T C 8: 110,993,111 probably benign Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Gm1110 G T 9: 26,881,126 probably benign Het
Gm5499 T C 17: 87,078,995 noncoding transcript Het
Gmnc G T 16: 26,963,979 probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hc G A 2: 35,000,765 probably benign Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Lrmp T G 6: 145,158,630 probably benign Het
Mad2l2 G T 4: 148,142,972 probably benign Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Myh13 T C 11: 67,362,581 probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Prrxl1 A G 14: 32,605,324 probably benign Het
Qtrt2 A G 16: 43,871,832 probably benign Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Kcng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Kcng1 APN 2 168268764 missense probably benign
IGL01316:Kcng1 APN 2 168269040 missense probably damaging 1.00
PIT4378001:Kcng1 UTSW 2 168262684 missense probably damaging 0.98
R0104:Kcng1 UTSW 2 168269046 missense probably damaging 1.00
R0692:Kcng1 UTSW 2 168262763 missense probably damaging 0.99
R1574:Kcng1 UTSW 2 168269041 missense probably damaging 1.00
R1591:Kcng1 UTSW 2 168268710 missense possibly damaging 0.76
R1731:Kcng1 UTSW 2 168268689 missense probably benign 0.00
R1937:Kcng1 UTSW 2 168263021 missense probably benign 0.02
R1960:Kcng1 UTSW 2 168262984 missense probably benign 0.03
R2145:Kcng1 UTSW 2 168269032 missense probably damaging 1.00
R4167:Kcng1 UTSW 2 168262697 missense probably damaging 1.00
R5215:Kcng1 UTSW 2 168263133 missense probably benign 0.20
R5816:Kcng1 UTSW 2 168268723 missense possibly damaging 0.90
R6367:Kcng1 UTSW 2 168262652 missense probably damaging 1.00
R7058:Kcng1 UTSW 2 168262609 missense probably damaging 1.00
X0063:Kcng1 UTSW 2 168269073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGATGGTGCCAAAAGCTC -3'
(R):5'- GATGTGAAGCCCCAAAATGACC -3'

Sequencing Primer
(F):5'- AAAAGCTCCGGGGTTGC -3'
(R):5'- AAATGACCCTGTTACCGGG -3'
Posted On2014-06-23