Mutagenetix > Incidental Mutation

Incidental Mutation 'R0092:Hipk2'

20273

Institutional Source

Beutler Lab

Gene Symbol

Hipk2

Ensembl Gene

ENSMUSG00000061436

Gene Name

homeodomain interacting protein kinase 2

Synonyms

B230339E18Rik, 1110014O20Rik, Stank

MMRRC Submission

038379-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R0092 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

38671325-38853099 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38720164 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 482 (D482G)

Ref Sequence

ENSEMBL: ENSMUSP00000125572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]

AlphaFold

Q9QZR5

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159307

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159894

Predicted Effect

probably damaging
Transcript: ENSMUST00000160360
AA Change: D489G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436
AA Change: D489G

Domain	Start	End	E-Value	Type
low complexity region	94	104	N/A	INTRINSIC
low complexity region	156	180	N/A	INTRINSIC
S_TKc	199	527	3.05e-78	SMART
low complexity region	895	909	N/A	INTRINSIC
low complexity region	963	992	N/A	INTRINSIC
low complexity region	998	1018	N/A	INTRINSIC
low complexity region	1057	1072	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160962
AA Change: D482G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436
AA Change: D482G

Domain	Start	End	E-Value	Type
low complexity region	87	97	N/A	INTRINSIC
low complexity region	149	173	N/A	INTRINSIC
S_TKc	192	520	3.05e-78	SMART
low complexity region	888	902	N/A	INTRINSIC
low complexity region	956	985	N/A	INTRINSIC
low complexity region	991	1011	N/A	INTRINSIC
low complexity region	1050	1065	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161779
AA Change: D489G

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436
AA Change: D489G

Domain	Start	End	E-Value	Type
low complexity region	94	104	N/A	INTRINSIC
low complexity region	156	180	N/A	INTRINSIC
S_TKc	199	527	3.05e-78	SMART
low complexity region	923	937	N/A	INTRINSIC
low complexity region	991	1020	N/A	INTRINSIC
low complexity region	1026	1046	N/A	INTRINSIC
low complexity region	1085	1100	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162359
AA Change: D489G

PolyPhen 2 Score 0.494 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436
AA Change: D489G

Domain	Start	End	E-Value	Type
low complexity region	94	104	N/A	INTRINSIC
low complexity region	156	180	N/A	INTRINSIC
S_TKc	199	527	3.05e-78	SMART
low complexity region	896	910	N/A	INTRINSIC
low complexity region	964	993	N/A	INTRINSIC
low complexity region	999	1019	N/A	INTRINSIC
low complexity region	1058	1073	N/A	INTRINSIC

Meta Mutation Damage Score

0.3128

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.1%
20x: 88.6%

Validation Efficiency

99% (112/113)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	T	A	6: 58,662,762 (GRCm39)	S535T	probably benign	Het
Acad11	A	T	9: 103,967,540 (GRCm39)		probably benign	Het
Acadm	A	T	3: 153,647,512 (GRCm39)		probably benign	Het
Acot12	T	A	13: 91,889,684 (GRCm39)	M12K	probably damaging	Het
Actr2	A	T	11: 20,044,308 (GRCm39)	N99K	probably benign	Het
Adam2	G	A	14: 66,291,336 (GRCm39)	A314V	probably damaging	Het
Agl	C	T	3: 116,587,453 (GRCm39)	R34Q	probably damaging	Het
Agrn	C	T	4: 156,263,410 (GRCm39)	R338H	probably damaging	Het
AI661453	A	G	17: 47,778,440 (GRCm39)		probably benign	Het
Alpk3	A	G	7: 80,742,301 (GRCm39)	D706G	probably benign	Het
Apbb1	T	C	7: 105,208,361 (GRCm39)	E648G	probably damaging	Het
Astn2	C	A	4: 66,322,219 (GRCm39)	A127S	unknown	Het
Asxl2	T	C	12: 3,546,313 (GRCm39)	S366P	probably benign	Het
Bdh1	A	T	16: 31,266,380 (GRCm39)	K92*	probably null	Het
Bltp1	A	G	3: 37,082,308 (GRCm39)	D3790G	probably benign	Het
Cacna1g	C	T	11: 94,348,090 (GRCm39)	S666N	probably damaging	Het
Ces2b	A	G	8: 105,563,144 (GRCm39)	T361A	possibly damaging	Het
Col6a4	T	A	9: 105,890,513 (GRCm39)	E1927V	probably benign	Het
Ctnnb1	T	G	9: 120,781,929 (GRCm39)	I314S	possibly damaging	Het
Cyp2c66	T	C	19: 39,172,224 (GRCm39)		probably benign	Het
Dennd4c	T	A	4: 86,699,844 (GRCm39)	F232I	probably damaging	Het
Dennd5a	T	C	7: 109,499,013 (GRCm39)	N950S	possibly damaging	Het
Dhx30	T	C	9: 109,914,078 (GRCm39)	N14S	possibly damaging	Het
Dip2b	T	A	15: 100,100,146 (GRCm39)	V1004D	probably damaging	Het
Dnah1	A	C	14: 30,993,566 (GRCm39)	S2872A	probably benign	Het
Dnajc10	T	C	2: 80,156,026 (GRCm39)	V233A	probably damaging	Het
E230025N22Rik	A	G	18: 36,822,277 (GRCm39)	L162P	probably damaging	Het
Elmod3	T	C	6: 72,543,792 (GRCm39)	D333G	probably benign	Het
Epb41l3	T	A	17: 69,593,745 (GRCm39)	M846K	probably damaging	Het
Frem2	A	G	3: 53,497,217 (GRCm39)	Y1766H	probably benign	Het
Fxr2	T	C	11: 69,532,972 (GRCm39)		probably benign	Het
Gmpr2	A	G	14: 55,915,402 (GRCm39)	R258G	probably benign	Het
Helb	T	C	10: 119,925,713 (GRCm39)	Y888C	probably damaging	Het
Hephl1	TTCCAGATGTCC	TTCC	9: 15,001,899 (GRCm39)		probably null	Het
Itgb4	G	T	11: 115,869,950 (GRCm39)	R44L	probably damaging	Het
Itih1	T	C	14: 30,662,820 (GRCm39)		probably benign	Het
Kit	T	A	5: 75,808,414 (GRCm39)	S719R	possibly damaging	Het
Krt13	G	A	11: 100,012,258 (GRCm39)	Q22*	probably null	Het
L3mbtl4	A	C	17: 68,732,698 (GRCm39)	R59S	probably benign	Het
Lpp	A	G	16: 24,580,352 (GRCm39)	S23G	probably benign	Het
Magi3	G	A	3: 103,958,280 (GRCm39)	Q602*	probably null	Het
Man2a1	A	G	17: 64,966,079 (GRCm39)		probably benign	Het
Muc5ac	A	G	7: 141,372,367 (GRCm39)	E2667G	possibly damaging	Het
Myef2l	G	A	3: 10,153,633 (GRCm39)	C134Y	possibly damaging	Het
Myo15b	C	G	11: 115,753,812 (GRCm39)	S842C	possibly damaging	Het
Naf1	T	A	8: 67,341,760 (GRCm39)	S462T	probably benign	Het
Necab3	T	C	2: 154,400,659 (GRCm39)	D34G	possibly damaging	Het
Nisch	C	A	14: 30,913,410 (GRCm39)		probably benign	Het
Nlrc5	T	C	8: 95,216,222 (GRCm39)		probably benign	Het
Nmt1	T	C	11: 102,937,319 (GRCm39)	F119L	probably damaging	Het
Nod1	T	G	6: 54,921,526 (GRCm39)	D264A	probably damaging	Het
Nol8	C	T	13: 49,815,923 (GRCm39)	A677V	possibly damaging	Het
Nt5e	T	A	9: 88,252,338 (GRCm39)	F567I	probably benign	Het
Obscn	A	T	11: 58,942,073 (GRCm39)	M4434K	possibly damaging	Het
Opa1	A	T	16: 29,444,412 (GRCm39)	D866V	probably damaging	Het
Or10a3m	T	C	7: 108,313,031 (GRCm39)	V145A	probably benign	Het
Or10al3	T	G	17: 38,011,696 (GRCm39)	L45R	probably damaging	Het
Or10p1	A	G	10: 129,444,090 (GRCm39)	S87P	probably damaging	Het
Or1j21	A	G	2: 36,683,508 (GRCm39)	T87A	probably benign	Het
Or51ai2	T	C	7: 103,586,934 (GRCm39)	S116P	probably damaging	Het
Otop1	T	A	5: 38,457,174 (GRCm39)	V311E	probably damaging	Het
Pcsk2	A	G	2: 143,642,944 (GRCm39)	D407G	probably damaging	Het
Pdcd1	A	G	1: 93,980,149 (GRCm39)	W23R	possibly damaging	Het
Pigp	A	G	16: 94,166,321 (GRCm39)	V129A	probably damaging	Het
Pik3r5	A	G	11: 68,383,629 (GRCm39)	R483G	probably benign	Het
Pink1	A	G	4: 138,047,309 (GRCm39)	V225A	probably benign	Het
Plcl1	C	G	1: 55,735,924 (GRCm39)	Q422E	probably damaging	Het
Plec	T	C	15: 76,067,943 (GRCm39)	E1222G	probably benign	Het
Polr1a	T	C	6: 71,944,439 (GRCm39)		probably benign	Het
Prokr2	C	T	2: 132,215,517 (GRCm39)	V154M	probably damaging	Het
Rasgrp4	A	G	7: 28,844,557 (GRCm39)	R280G	possibly damaging	Het
Rmnd5b	T	C	11: 51,520,419 (GRCm39)	E8G	possibly damaging	Het
Sbf2	T	A	7: 109,920,013 (GRCm39)		probably benign	Het
Sec23b	A	G	2: 144,408,830 (GRCm39)	M172V	probably benign	Het
Setx	T	C	2: 29,036,305 (GRCm39)	V930A	probably benign	Het
Sft2d2	G	A	1: 165,006,829 (GRCm39)	A159V	possibly damaging	Het
Sh3gl1	G	T	17: 56,325,088 (GRCm39)	R250S	probably benign	Het
Skor1	C	A	9: 63,053,277 (GRCm39)	D231Y	probably damaging	Het
Slc24a1	T	G	9: 64,856,034 (GRCm39)	E291A	unknown	Het
Slc28a2b	G	T	2: 122,348,078 (GRCm39)		probably benign	Het
Smc1b	A	T	15: 84,951,925 (GRCm39)		probably benign	Het
Tbccd1	A	T	16: 22,644,844 (GRCm39)	N177K	possibly damaging	Het
Tdp1	T	A	12: 99,921,248 (GRCm39)	Y595N	probably damaging	Het
Tle5	G	A	10: 81,397,054 (GRCm39)	G10D	possibly damaging	Het
Tmem108	T	C	9: 103,366,504 (GRCm39)	K496E	possibly damaging	Het
Tmprss7	T	C	16: 45,487,959 (GRCm39)	D490G	probably damaging	Het
Tnrc6b	A	T	15: 80,802,729 (GRCm39)	N1511Y	probably damaging	Het
Top2b	G	A	14: 16,409,263 (GRCm38)	R802Q	probably damaging	Het
Trip10	A	T	17: 57,557,798 (GRCm39)	K27N	possibly damaging	Het
Txlnb	A	G	10: 17,718,503 (GRCm39)	N445D	possibly damaging	Het
Txnrd1	T	A	10: 82,715,636 (GRCm39)	I159N	probably damaging	Het
Ulk1	C	A	5: 110,944,193 (GRCm39)	A164S	probably null	Het
Vmn2r83	T	C	10: 79,327,798 (GRCm39)	V802A	probably damaging	Het
Zbtb4	A	G	11: 69,670,177 (GRCm39)	I967V	probably benign	Het

Other mutations in Hipk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Hipk2	APN	6	38,796,257 (GRCm39)	splice site	probably benign
IGL00814:Hipk2	APN	6	38,795,484 (GRCm39)	missense	probably damaging	1.00
IGL00907:Hipk2	APN	6	38,795,208 (GRCm39)	missense	probably damaging	1.00
IGL01350:Hipk2	APN	6	38,795,250 (GRCm39)	missense	probably damaging	1.00
IGL01714:Hipk2	APN	6	38,796,117 (GRCm39)	missense	probably damaging	1.00
IGL01893:Hipk2	APN	6	38,795,330 (GRCm39)	missense	probably benign	0.05
IGL02028:Hipk2	APN	6	38,795,691 (GRCm39)	missense	possibly damaging	0.67
IGL02133:Hipk2	APN	6	38,796,069 (GRCm39)	missense	probably benign
IGL02135:Hipk2	APN	6	38,795,934 (GRCm39)	missense	possibly damaging	0.90
IGL02543:Hipk2	APN	6	38,680,436 (GRCm39)	missense	possibly damaging	0.95
IGL02630:Hipk2	APN	6	38,795,456 (GRCm39)	missense	possibly damaging	0.48
IGL02896:Hipk2	APN	6	38,675,382 (GRCm39)	missense	probably damaging	1.00
IGL02900:Hipk2	APN	6	38,706,879 (GRCm39)	missense	probably damaging	0.96
IGL03345:Hipk2	APN	6	38,724,937 (GRCm39)	splice site	probably benign
R0070:Hipk2	UTSW	6	38,795,919 (GRCm39)	nonsense	probably null
R0070:Hipk2	UTSW	6	38,795,919 (GRCm39)	nonsense	probably null
R0184:Hipk2	UTSW	6	38,695,866 (GRCm39)	missense	possibly damaging	0.77
R0494:Hipk2	UTSW	6	38,706,924 (GRCm39)	missense	probably benign	0.03
R0617:Hipk2	UTSW	6	38,724,420 (GRCm39)	missense	possibly damaging	0.70
R0720:Hipk2	UTSW	6	38,675,491 (GRCm39)	missense	probably damaging	1.00
R1812:Hipk2	UTSW	6	38,675,098 (GRCm39)	missense	probably benign	0.14
R1864:Hipk2	UTSW	6	38,695,870 (GRCm39)	critical splice acceptor site	probably null
R1919:Hipk2	UTSW	6	38,795,919 (GRCm39)	nonsense	probably null
R1995:Hipk2	UTSW	6	38,692,909 (GRCm39)	missense	probably damaging	1.00
R2079:Hipk2	UTSW	6	38,795,720 (GRCm39)	missense	probably damaging	1.00
R2238:Hipk2	UTSW	6	38,706,850 (GRCm39)	splice site	probably benign
R2384:Hipk2	UTSW	6	38,795,306 (GRCm39)	missense	probably damaging	0.99
R3775:Hipk2	UTSW	6	38,720,029 (GRCm39)	missense	probably damaging	0.99
R3792:Hipk2	UTSW	6	38,675,491 (GRCm39)	missense	probably damaging	1.00
R3841:Hipk2	UTSW	6	38,795,861 (GRCm39)	missense	probably damaging	1.00
R3883:Hipk2	UTSW	6	38,676,200 (GRCm39)	missense	probably damaging	1.00
R4471:Hipk2	UTSW	6	38,713,857 (GRCm39)	intron	probably benign
R4724:Hipk2	UTSW	6	38,675,327 (GRCm39)	missense	probably benign	0.10
R4838:Hipk2	UTSW	6	38,795,339 (GRCm39)	missense	possibly damaging	0.94
R4843:Hipk2	UTSW	6	38,796,192 (GRCm39)	missense	possibly damaging	0.94
R5040:Hipk2	UTSW	6	38,707,816 (GRCm39)	missense	possibly damaging	0.82
R5044:Hipk2	UTSW	6	38,795,814 (GRCm39)	missense	probably benign	0.06
R5320:Hipk2	UTSW	6	38,795,212 (GRCm39)	missense	probably damaging	1.00
R5409:Hipk2	UTSW	6	38,706,977 (GRCm39)	missense	probably damaging	1.00
R5682:Hipk2	UTSW	6	38,714,408 (GRCm39)	missense	possibly damaging	0.50
R5695:Hipk2	UTSW	6	38,795,810 (GRCm39)	missense	possibly damaging	0.64
R5876:Hipk2	UTSW	6	38,707,802 (GRCm39)	critical splice donor site	probably null
R6309:Hipk2	UTSW	6	38,675,446 (GRCm39)	missense	probably damaging	1.00
R6612:Hipk2	UTSW	6	38,795,808 (GRCm39)	missense	probably benign	0.04
R6815:Hipk2	UTSW	6	38,795,777 (GRCm39)	missense	probably damaging	1.00
R7104:Hipk2	UTSW	6	38,795,579 (GRCm39)	missense	probably damaging	0.98
R7124:Hipk2	UTSW	6	38,795,413 (GRCm39)	nonsense	probably null
R7238:Hipk2	UTSW	6	38,692,992 (GRCm39)	missense	probably benign	0.45
R7712:Hipk2	UTSW	6	38,680,569 (GRCm39)	missense	probably benign	0.02
R7994:Hipk2	UTSW	6	38,795,403 (GRCm39)	missense	possibly damaging	0.94
R8190:Hipk2	UTSW	6	38,795,728 (GRCm39)	missense	possibly damaging	0.88
R8388:Hipk2	UTSW	6	38,722,630 (GRCm39)	missense	probably damaging	1.00
R8796:Hipk2	UTSW	6	38,675,158 (GRCm39)	missense	probably damaging	0.99
R9041:Hipk2	UTSW	6	38,724,909 (GRCm39)	nonsense	probably null
R9388:Hipk2	UTSW	6	38,707,956 (GRCm39)	missense	probably damaging	1.00
R9480:Hipk2	UTSW	6	38,680,377 (GRCm39)	missense	probably benign	0.37
R9485:Hipk2	UTSW	6	38,680,445 (GRCm39)	missense	possibly damaging	0.94
R9562:Hipk2	UTSW	6	38,724,390 (GRCm39)	missense	probably damaging	0.99
R9565:Hipk2	UTSW	6	38,724,390 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGGCACTTACTGGGCACTATGGG -3'
(R):5'- GTGTGATGAAAGCTGCACTTCACC -3'

Sequencing Primer
(F):5'- CACTATGGGGGAAGTCAAGC -3'
(R):5'- CCATTCTGTTCCTAGCGTATAAGAGG -3'

Protein Function and Prediction

Homeodomain interacting protein kinase 2 (Hipk2) is a conserved serine/threonine kinase that interacts with and phosphorylates homeodomain transcription factors to regulate transcription during development and in response to DNA damage (1). Hipk2 has a conserved N-terminal kinase domain with a DYRK motif, a nuclear localization sequence, a PEST domain, and C-terminal region that contains speckle-retention signal, an autoinhibitory domain, and a ubiquitylation site (1;2).

Northern blot analysis detected ubiquitous expression of a 11.0-kb HIPK2 transcript, with strongest expression in human neuronal tissue; a 7.8-kb transcript was detected in the uterus and a 1.4-kb transcript was detected in the pancreas (3). Hipk2 is detectable in postnatal day (P) 15 mouse embryos and is strong by P17 (4). In situ hybridization detected expression in neural retina, telencephalon, and muscle at P16.5 (4). Similar to human HIPK2, mouse Hipk2 is ubiquitously expressed in the adult, Pierantoni et al. detected highest expression in the heart, muscle and kidney by RT-PCR (4).

Hipk2^{tm1Hko/tm1Hko}; MGI:3624127

involves: C57BL/6

Embyronic fibroblasts from null mice are slightly resistant to UV radiation (5). Also, there are more frequent instances of neural tube defects in these mice (5).

Hipk2^{tm1Ejh/tm1Ejh}; MGI:3487301

involves: 129X1/SvJ * C57BL/6

Homozygous mice exhibit diminished locomotor activity response to amphetamine compared with wild-type mice as well as abnormal limb grasping, impaired coordination, abnormal voluntary movement, and abnormal gait (6). There is also decreased neuron apoptosis in dopaminergic neurons at E17.5 and P0 (6). Homozygotes have decreased dopaminergic neuron number throughout life (6).

Hipk2^{tm1Ejh/tm1Ejh}; MGI:3487301

involves: 129X1/SvJ * C57BL/6J

In this genetic background, homozygotes have more neurons in the trigeminal ganglion at E13.5 and P0 due to a reduction in apoptotic neurons (7).

Hipk2^{tm1Afus/tm1Afus}; MGI:4429497

involves: 129X1/SvJ * C57BL/6

Homozygotes in this model have abnormal motor capabilities/coordination/movement as well as an increase in the number of mouse embryonic fibroblasts in the G0/G1 phase of the cell cycle and reduced proliferation (8). Homozygotes have decreased birth and body weight over their life (8).

References

1. Rinaldo, C., Prodosmo, A., Siepi, F., and Soddu, S. (2007) HIPK2: A Multitalented Partner for Transcription Factors in DNA Damage Response and Development. Biochem Cell Biol. 85, 411-418.

2. Hofmann, T. G., Mincheva, A., Lichter, P., Droge, W., and Schmitz, M. L. (2000) Human Homeodomain-Interacting Protein Kinase-2 (HIPK2) is a Member of the DYRK Family of Protein Kinases and Maps to Chromosome 7q32-q34. Biochimie. 82, 1123-1127.

3. Wang, Y., Hofmann, T. G., Runkel, L., Haaf, T., Schaller, H., Debatin, K., and Hug, H. (2001) Isolation and Characterization of cDNAs for the Protein Kinase HIPK2. Biochim Biophys Acta. 1518, 168-172.

4. Pierantoni, G. M., Bulfone, A., Pentimalli, F., Fedele, M., Iuliano, R., Santoro, M., Chiariotti, L., Ballabio, A., and Fusco, A. (2002) The Homeodomain-Interacting Protein Kinase 2 Gene is Expressed Late in Embryogenesis and Preferentially in Retina, Muscle, and Neural Tissues. Biochem Biophys Res Commun. 290, 942-947.

5. Isono, K., Nemoto, K., Li, Y., Takada, Y., Suzuki, R., Katsuki, M., Nakagawara, A., and Koseki, H. (2006) Overlapping Roles for Homeodomain-Interacting Protein Kinases hipk1 and hipk2 in the Mediation of Cell Growth in Response to Morphogenetic and Genotoxic Signals. Mol Cell Biol. 26, 2758-2771.

6. Zhang, J., Pho, V., Bonasera, S. J., Holtzman, J., Tang, A. T., Hellmuth, J., Tang, S., Janak, P. H., Tecott, L. H., and Huang, E. J. (2007) Essential Function of HIPK2 in TGFbeta-Dependent Survival of Midbrain Dopamine Neurons. Nat Neurosci. 10, 77-86.

7. Wiggins, A. K., Wei, G., Doxakis, E., Wong, C., Tang, A. A., Zang, K., Luo, E. J., Neve, R. L., Reichardt, L. F., and Huang, E. J. (2004) Interaction of Brn3a and HIPK2 Mediates Transcriptional Repression of Sensory Neuron Survival. J Cell Biol. 167, 257-267.

8. Trapasso, F., Aqeilan, R. I., Iuliano, R., Visone, R., Gaudio, E., Ciuffini, L., Alder, H., Paduano, F., Pierantoni, G. M., Soddu, S., Croce, C. M., and Fusco, A. (2009) Targeted Disruption of the Murine Homeodomain-Interacting Protein Kinase-2 Causes Growth Deficiency in Vivo and Cell Cycle Arrest in Vitro. DNA Cell Biol. 28, 161-167.

Posted On

2013-04-11

Science Writer

Anne Murray