Incidental Mutation 'R1574:Ncoa7'
ID202740
Institutional Source Beutler Lab
Gene Symbol Ncoa7
Ensembl Gene ENSMUSG00000039697
Gene Namenuclear receptor coactivator 7
Synonyms9030406N13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location30628999-30803326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30694101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 249 (I249M)
Ref Sequence ENSEMBL: ENSMUSP00000150021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000213836] [ENSMUST00000215725] [ENSMUST00000215740] [ENSMUST00000215926]
Predicted Effect probably damaging
Transcript: ENSMUST00000068567
AA Change: I287M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: I287M

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
LysM 118 161 2.24e-7 SMART
low complexity region 165 176 N/A INTRINSIC
TLDc 781 943 2.86e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213836
AA Change: I287M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215725
Predicted Effect probably damaging
Transcript: ENSMUST00000215740
AA Change: I287M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215926
AA Change: I249M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217398
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apeh A T 9: 108,092,726 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cdc25b T A 2: 131,191,137 probably benign Het
Cdon A G 9: 35,452,937 probably benign Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Ddx19a T C 8: 110,993,111 probably benign Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Gm1110 G T 9: 26,881,126 probably benign Het
Gm5499 T C 17: 87,078,995 noncoding transcript Het
Gmnc G T 16: 26,963,979 probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hc G A 2: 35,000,765 probably benign Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Lrmp T G 6: 145,158,630 probably benign Het
Mad2l2 G T 4: 148,142,972 probably benign Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Myh13 T C 11: 67,362,581 probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Prrxl1 A G 14: 32,605,324 probably benign Het
Qtrt2 A G 16: 43,871,832 probably benign Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Ncoa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ncoa7 APN 10 30690840 missense probably damaging 1.00
IGL01716:Ncoa7 APN 10 30662334 missense probably damaging 0.96
IGL02114:Ncoa7 APN 10 30662364 missense probably damaging 1.00
IGL02170:Ncoa7 APN 10 30689853 missense possibly damaging 0.94
IGL02436:Ncoa7 APN 10 30694147 missense probably damaging 1.00
IGL02499:Ncoa7 APN 10 30690889 missense probably benign 0.04
IGL02533:Ncoa7 APN 10 30690899 missense possibly damaging 0.87
IGL02533:Ncoa7 APN 10 30722785 missense probably damaging 1.00
IGL02590:Ncoa7 APN 10 30694163 missense probably damaging 1.00
IGL02657:Ncoa7 APN 10 30652976 missense probably damaging 1.00
IGL03065:Ncoa7 APN 10 30647997 missense probably damaging 1.00
IGL03088:Ncoa7 APN 10 30698125 splice site probably null
IGL03090:Ncoa7 APN 10 30662400 missense probably damaging 0.96
IGL03196:Ncoa7 APN 10 30647514 utr 3 prime probably benign
D6062:Ncoa7 UTSW 10 30722655 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0578:Ncoa7 UTSW 10 30701917 critical splice donor site probably null
R0729:Ncoa7 UTSW 10 30691579 missense probably benign 0.00
R1538:Ncoa7 UTSW 10 30694211 missense probably damaging 0.99
R1539:Ncoa7 UTSW 10 30771729 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1624:Ncoa7 UTSW 10 30704659 missense possibly damaging 0.87
R1639:Ncoa7 UTSW 10 30701992 missense probably damaging 1.00
R1655:Ncoa7 UTSW 10 30698245 critical splice acceptor site probably null
R1876:Ncoa7 UTSW 10 30698126 intron probably benign
R1885:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1886:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1887:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1909:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R1938:Ncoa7 UTSW 10 30698170 missense probably benign 0.02
R1965:Ncoa7 UTSW 10 30654430 nonsense probably null
R1978:Ncoa7 UTSW 10 30691299 missense probably benign
R2303:Ncoa7 UTSW 10 30654435 missense probably damaging 1.00
R3777:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R3778:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R4026:Ncoa7 UTSW 10 30722724 missense probably benign 0.02
R4230:Ncoa7 UTSW 10 30698257 splice site probably null
R4667:Ncoa7 UTSW 10 30690790 missense probably damaging 1.00
R4786:Ncoa7 UTSW 10 30655642 missense probably benign 0.28
R4809:Ncoa7 UTSW 10 30771762 missense possibly damaging 0.92
R4820:Ncoa7 UTSW 10 30648476 missense probably damaging 1.00
R4839:Ncoa7 UTSW 10 30722659 missense possibly damaging 0.93
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R5271:Ncoa7 UTSW 10 30722729 missense probably benign 0.02
R5384:Ncoa7 UTSW 10 30722817 missense probably benign 0.00
R5418:Ncoa7 UTSW 10 30648039 missense probably damaging 1.00
R5964:Ncoa7 UTSW 10 30704636 missense probably damaging 1.00
R6257:Ncoa7 UTSW 10 30694177 missense probably damaging 1.00
R6683:Ncoa7 UTSW 10 30771721 missense probably damaging 0.99
R6813:Ncoa7 UTSW 10 30696192 missense probably damaging 1.00
R6910:Ncoa7 UTSW 10 30694121 missense possibly damaging 0.89
R7123:Ncoa7 UTSW 10 30654439 missense probably benign 0.28
R7327:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R7412:Ncoa7 UTSW 10 30722851 missense possibly damaging 0.94
R7638:Ncoa7 UTSW 10 30722798 missense probably benign 0.35
R7653:Ncoa7 UTSW 10 30694243 missense probably damaging 1.00
R7848:Ncoa7 UTSW 10 30648418 missense possibly damaging 0.82
R7861:Ncoa7 UTSW 10 30691060 missense probably benign 0.38
R7931:Ncoa7 UTSW 10 30648418 missense possibly damaging 0.82
R7944:Ncoa7 UTSW 10 30691060 missense probably benign 0.38
R8125:Ncoa7 UTSW 10 30694091 missense possibly damaging 0.80
R8198:Ncoa7 UTSW 10 30704668 missense probably benign 0.00
R8240:Ncoa7 UTSW 10 30691729 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ACGCCAGGTAGATCTTAAATAGC -3'
(R):5'- ACATGGAAGGTTCTGTGATGGC -3'

Sequencing Primer
(F):5'- GTCCCTTGCTTCTGCAAAT -3'
(R):5'- AAGGTTCTGTGATGGCTGAGGAATAC -3'
Posted On2014-06-23