Incidental Mutation 'R1574:Prrxl1'
ID202754
Institutional Source Beutler Lab
Gene Symbol Prrxl1
Ensembl Gene ENSMUSG00000041730
Gene Namepaired related homeobox protein-like 1
SynonymsDrg11
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32599407-32649246 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 32605324 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068938] [ENSMUST00000186452] [ENSMUST00000187377] [ENSMUST00000189022] [ENSMUST00000228878]
Predicted Effect probably benign
Transcript: ENSMUST00000068938
SMART Domains Protein: ENSMUSP00000064107
Gene: ENSMUSG00000041730

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186452
SMART Domains Protein: ENSMUSP00000139756
Gene: ENSMUSG00000041730

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187377
SMART Domains Protein: ENSMUSP00000140687
Gene: ENSMUSG00000041730

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189022
SMART Domains Protein: ENSMUSP00000140337
Gene: ENSMUSG00000041730

DomainStartEndE-ValueType
HOX 33 95 9.62e-29 SMART
low complexity region 111 122 N/A INTRINSIC
Pfam:OAR 199 219 4.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228878
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice had delayed projection of sensory afferent neurons in the dorsal, but not the ventral, spinal cord during embryonic development. This delayed development resulted in abnormal responses to noxious stimuli in adults, but normal locomotion and sensory motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apeh A T 9: 108,092,726 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cdc25b T A 2: 131,191,137 probably benign Het
Cdon A G 9: 35,452,937 probably benign Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Ddx19a T C 8: 110,993,111 probably benign Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Gm1110 G T 9: 26,881,126 probably benign Het
Gm5499 T C 17: 87,078,995 noncoding transcript Het
Gmnc G T 16: 26,963,979 probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hc G A 2: 35,000,765 probably benign Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Lrmp T G 6: 145,158,630 probably benign Het
Mad2l2 G T 4: 148,142,972 probably benign Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Myh13 T C 11: 67,362,581 probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Qtrt2 A G 16: 43,871,832 probably benign Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Prrxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Prrxl1 APN 14 32605214 splice site probably benign
IGL01868:Prrxl1 APN 14 32608377 missense probably damaging 0.99
R0436:Prrxl1 UTSW 14 32608083 missense probably damaging 1.00
R1395:Prrxl1 UTSW 14 32608369 missense probably benign 0.05
R2093:Prrxl1 UTSW 14 32647155 intron probably benign
R3700:Prrxl1 UTSW 14 32628861 missense probably damaging 1.00
R4922:Prrxl1 UTSW 14 32608406 missense probably damaging 1.00
R4944:Prrxl1 UTSW 14 32608249 missense probably damaging 1.00
R4962:Prrxl1 UTSW 14 32647144 intron probably benign
R5512:Prrxl1 UTSW 14 32600044 missense probably damaging 0.99
R5989:Prrxl1 UTSW 14 32608188 missense probably benign 0.01
R7423:Prrxl1 UTSW 14 32628821 missense probably damaging 1.00
R7790:Prrxl1 UTSW 14 32628888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACTGCTTCCTCACCAC -3'
(R):5'- TAGTACCTTAGAGACGCGGAC -3'

Sequencing Primer
(F):5'- ACCCCTCAGCTCTGATCTATG -3'
(R):5'- CCAAATGTGCACTCTGCA -3'
Posted On2014-06-23