Mutagenetix > Incidental Mutation

Incidental Mutation 'R1574:Greb1l'

202769

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

045014-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1574 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 10554997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1681 (D1681G)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977]

AlphaFold

B9EJV3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048977
AA Change: D1681G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: D1681G

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122744

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173261

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.0%

Validation Efficiency

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	A	5: 81,787,449	N1276K	probably damaging	Het
Als2cl	A	G	9: 110,884,060	E6G	probably damaging	Het
Ankrd12	A	T	17: 65,986,274	D721E	probably benign	Het
Anpep	A	G	7: 79,838,407		probably null	Het
Apeh	A	T	9: 108,092,726		probably null	Het
Apob	A	T	12: 7,990,839	I655L	possibly damaging	Het
Atp2b1	T	A	10: 98,996,948	L437Q	probably damaging	Het
Cacna2d3	T	A	14: 29,351,822	R222S	probably damaging	Het
Cdc25b	T	A	2: 131,191,137		probably benign	Het
Cdon	A	G	9: 35,452,937		probably benign	Het
Cenpf	C	T	1: 189,652,713	D2457N	probably damaging	Het
Cenpo	A	T	12: 4,215,433		probably null	Het
Ces2b	G	T	8: 104,835,889	A284S	probably benign	Het
Clock	T	C	5: 76,242,832	D311G	probably damaging	Het
Csmd3	T	C	15: 47,695,861		probably null	Het
Dbil5	A	G	11: 76,218,482	M71V	probably benign	Het
Ddhd1	A	C	14: 45,595,547	L864R	probably damaging	Het
Ddx19a	T	C	8: 110,993,111		probably benign	Het
Dnah11	A	G	12: 118,060,317	C1900R	probably damaging	Het
Dnah2	A	G	11: 69,514,688	V666A	probably benign	Het
Dnah5	T	A	15: 28,252,423	M754K	probably benign	Het
Dnajc15	A	T	14: 77,826,414	S145T	probably benign	Het
Drap1	A	G	19: 5,424,257	F25S	probably damaging	Het
Fam83e	G	A	7: 45,726,711	E283K	probably damaging	Het
Fbxo48	G	T	11: 16,953,368		probably benign	Het
Fndc3a	A	T	14: 72,556,557	I892N	probably damaging	Het
Gcn1l1	A	G	5: 115,615,552	T2321A	probably benign	Het
Gm1110	G	T	9: 26,881,126		probably benign	Het
Gm5499	T	C	17: 87,078,995		noncoding transcript	Het
Gmnc	G	T	16: 26,963,979		probably benign	Het
Hc	G	A	2: 35,000,765		probably benign	Het
Hmcn2	A	C	2: 31,404,887	T2563P	probably damaging	Het
Iqcd	A	T	5: 120,600,235	K39N	probably damaging	Het
Kank2	A	G	9: 21,774,575	S668P	probably damaging	Het
Kcng1	T	A	2: 168,269,041	N68Y	probably damaging	Het
Kmt5b	T	A	19: 3,786,633		probably null	Het
Lama2	T	A	10: 27,324,754	I533F	possibly damaging	Het
Lcmt1	T	A	7: 123,402,908	I132N	probably damaging	Het
Lrmp	T	G	6: 145,158,630		probably benign	Het
Mad2l2	G	T	4: 148,142,972		probably benign	Het
Mcph1	T	C	8: 18,801,412	I807T	probably damaging	Het
Mdn1	A	G	4: 32,722,315	I2366V	probably benign	Het
Moxd1	T	C	10: 24,300,319	W558R	probably damaging	Het
Myh13	T	C	11: 67,362,581		probably benign	Het
Myrf	T	C	19: 10,225,487	D141G	probably damaging	Het
Ncoa7	T	C	10: 30,694,101	I249M	probably damaging	Het
Obox5	T	C	7: 15,758,633	V171A	probably damaging	Het
Olfr1352	C	A	10: 78,983,986	N32K	probably damaging	Het
Olfr15	T	C	16: 3,839,657	I228T	probably damaging	Het
Olfr70	A	T	4: 43,697,134	V13D	possibly damaging	Het
Olfr818	A	G	10: 129,945,510	L69P	probably damaging	Het
Olfr988	A	T	2: 85,353,899	V9E	probably damaging	Het
Parp4	A	G	14: 56,602,295	T487A	probably damaging	Het
Pclo	A	G	5: 14,679,831		probably benign	Het
Pcnx2	G	A	8: 125,773,930	R1474C	probably damaging	Het
Prrxl1	A	G	14: 32,605,324		probably benign	Het
Qtrt2	A	G	16: 43,871,832		probably benign	Het
Sart1	G	A	19: 5,380,259	P788L	probably damaging	Het
Sdk1	A	G	5: 141,998,879	T740A	probably benign	Het
Serpinb1c	T	C	13: 32,888,996	D61G	possibly damaging	Het
Slc24a5	G	A	2: 125,080,862	G152S	probably damaging	Het
Slc6a4	A	T	11: 77,019,196	I426F	possibly damaging	Het
Stk33	C	T	7: 109,279,820	V441I	probably benign	Het
Sult1c2	A	G	17: 53,836,899		probably null	Het
Tdpoz4	T	A	3: 93,796,528	V44E	probably benign	Het
Tmprss13	C	A	9: 45,343,231	T432K	probably damaging	Het
Traf7	A	G	17: 24,510,553	L428P	probably damaging	Het
Tubb1	T	C	2: 174,457,422	I299T	probably benign	Het
Vmn1r158	A	T	7: 22,790,347	W146R	probably damaging	Het
Vmn1r42	A	G	6: 89,845,077	I170T	possibly damaging	Het
Vmn2r116	A	T	17: 23,387,089	H325L	probably damaging	Het
Zfp516	T	A	18: 82,993,175	L1111H	possibly damaging	Het
Zfp61	C	G	7: 24,291,210	K505N	probably damaging	Het
Zfp653	C	A	9: 22,057,978	E331*	probably null	Het
Zfp949	A	T	9: 88,569,777	K467*	probably null	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTACAGAAGCAGGAATTTCCAG -3'
(R):5'- GCAGAACAATATCAAGGGTCTACGTC -3'

Sequencing Primer
(F):5'- TCCAGTAAGAATGTGTCCCTG -3'
(R):5'- ATCAAGGGTCTACGTCATGCTAG -3'

Posted On

2014-06-23