Incidental Mutation 'R1786:Mov10'
ID 202794
Institutional Source Beutler Lab
Gene Symbol Mov10
Ensembl Gene ENSMUSG00000002227
Gene Name Mov10 RISC complex RNA helicase
Synonyms Mov-10
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 104702152-104725879 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104725432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 59 (I59N)
Ref Sequence ENSEMBL: ENSMUSP00000126897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002297] [ENSMUST00000094028] [ENSMUST00000106774] [ENSMUST00000106775] [ENSMUST00000136148] [ENSMUST00000166979] [ENSMUST00000168015]
AlphaFold P23249
Predicted Effect probably benign
Transcript: ENSMUST00000002297
SMART Domains Protein: ENSMUSP00000002297
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094028
SMART Domains Protein: ENSMUSP00000102381
Gene: ENSMUSG00000070372

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 14 282 3.1e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106774
SMART Domains Protein: ENSMUSP00000102386
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106775
AA Change: I59N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102387
Gene: ENSMUSG00000002227
AA Change: I59N

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136148
AA Change: F71I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145414
Predicted Effect possibly damaging
Transcript: ENSMUST00000166979
AA Change: I59N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126897
Gene: ENSMUSG00000002227
AA Change: I59N

DomainStartEndE-ValueType
low complexity region 61 75 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
low complexity region 411 426 N/A INTRINSIC
AAA 590 772 5.72e-3 SMART
low complexity region 1026 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168015
SMART Domains Protein: ENSMUSP00000128246
Gene: ENSMUSG00000002227

DomainStartEndE-ValueType
low complexity region 297 312 N/A INTRINSIC
low complexity region 338 353 N/A INTRINSIC
AAA 517 699 5.72e-3 SMART
low complexity region 953 970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196211
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype PHENOTYPE: Homozygous knockout is embryonic lethal. Heterozygous knockout leads to reduced dendritic branching of neurons, which affects anxiety- and/or activity-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Mov10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Mov10 APN 3 104,708,263 (GRCm39) splice site probably benign
IGL01111:Mov10 APN 3 104,708,721 (GRCm39) missense possibly damaging 0.71
IGL01315:Mov10 APN 3 104,703,261 (GRCm39) missense probably damaging 0.98
IGL01463:Mov10 APN 3 104,707,640 (GRCm39) missense probably damaging 1.00
IGL02114:Mov10 APN 3 104,702,634 (GRCm39) unclassified probably benign
IGL02354:Mov10 APN 3 104,711,437 (GRCm39) splice site probably benign
IGL02361:Mov10 APN 3 104,711,437 (GRCm39) splice site probably benign
IGL02692:Mov10 APN 3 104,708,119 (GRCm39) nonsense probably null
IGL03104:Mov10 APN 3 104,704,623 (GRCm39) missense probably damaging 1.00
IGL03121:Mov10 APN 3 104,708,318 (GRCm39) missense probably benign
P0040:Mov10 UTSW 3 104,711,995 (GRCm39) missense probably damaging 1.00
R0025:Mov10 UTSW 3 104,711,919 (GRCm39) missense probably damaging 1.00
R0270:Mov10 UTSW 3 104,702,721 (GRCm39) missense probably benign 0.09
R0747:Mov10 UTSW 3 104,709,812 (GRCm39) missense probably benign 0.41
R1434:Mov10 UTSW 3 104,702,490 (GRCm39) missense probably damaging 1.00
R1482:Mov10 UTSW 3 104,711,862 (GRCm39) missense probably damaging 0.98
R1594:Mov10 UTSW 3 104,702,727 (GRCm39) missense probably damaging 1.00
R1656:Mov10 UTSW 3 104,706,912 (GRCm39) missense probably benign 0.03
R1739:Mov10 UTSW 3 104,707,598 (GRCm39) missense probably damaging 0.98
R1785:Mov10 UTSW 3 104,725,432 (GRCm39) missense possibly damaging 0.73
R1911:Mov10 UTSW 3 104,708,876 (GRCm39) splice site probably benign
R1962:Mov10 UTSW 3 104,704,293 (GRCm39) missense probably damaging 1.00
R1993:Mov10 UTSW 3 104,706,735 (GRCm39) missense probably damaging 1.00
R2095:Mov10 UTSW 3 104,708,847 (GRCm39) missense probably damaging 1.00
R2138:Mov10 UTSW 3 104,711,558 (GRCm39) missense probably benign 0.00
R3107:Mov10 UTSW 3 104,707,040 (GRCm39) missense probably damaging 1.00
R4241:Mov10 UTSW 3 104,704,592 (GRCm39) missense probably benign 0.45
R4280:Mov10 UTSW 3 104,707,095 (GRCm39) missense probably damaging 0.98
R4474:Mov10 UTSW 3 104,725,781 (GRCm39) missense probably damaging 1.00
R5227:Mov10 UTSW 3 104,709,894 (GRCm39) missense probably benign
R5391:Mov10 UTSW 3 104,709,849 (GRCm39) missense probably benign 0.12
R5704:Mov10 UTSW 3 104,706,912 (GRCm39) missense probably benign 0.03
R5819:Mov10 UTSW 3 104,708,828 (GRCm39) missense probably damaging 1.00
R5842:Mov10 UTSW 3 104,706,695 (GRCm39) splice site probably benign
R6059:Mov10 UTSW 3 104,725,266 (GRCm39) utr 3 prime probably benign
R6692:Mov10 UTSW 3 104,725,360 (GRCm39) missense probably damaging 0.97
R7226:Mov10 UTSW 3 104,708,328 (GRCm39) missense probably damaging 1.00
R7426:Mov10 UTSW 3 104,707,368 (GRCm39) splice site probably null
R7633:Mov10 UTSW 3 104,704,381 (GRCm39) missense possibly damaging 0.93
R7637:Mov10 UTSW 3 104,703,201 (GRCm39) missense probably benign 0.26
R7869:Mov10 UTSW 3 104,711,994 (GRCm39) missense probably damaging 1.00
R8684:Mov10 UTSW 3 104,711,690 (GRCm39) missense probably benign
R9008:Mov10 UTSW 3 104,707,332 (GRCm39) missense probably benign 0.09
R9127:Mov10 UTSW 3 104,711,659 (GRCm39) nonsense probably null
R9559:Mov10 UTSW 3 104,708,277 (GRCm39) missense
R9587:Mov10 UTSW 3 104,711,899 (GRCm39) missense probably benign 0.11
R9602:Mov10 UTSW 3 104,708,284 (GRCm39) missense probably benign 0.18
R9606:Mov10 UTSW 3 104,707,664 (GRCm39) missense probably benign 0.00
R9708:Mov10 UTSW 3 104,704,613 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGTGGTTGTAAATCGTCCGC -3'
(R):5'- GATATCCACGTTCGGATCCTG -3'

Sequencing Primer
(F):5'- TTGTAAATCGTCCGCAGCCG -3'
(R):5'- GACTCCTTAGGAAAGAGTTAATGTG -3'
Posted On 2014-06-23