Mutagenetix > Incidental Mutation

Incidental Mutation 'R1786:Akap13'

202812

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

039817-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1786 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 75611434 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1269 (A1269S)

Ref Sequence

ENSEMBL: ENSMUSP00000147237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000147005
AA Change: A1269S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: A1269S

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
internal_repeat_1	485	695	4.85e-5	PROSPERO
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
Pfam:RII_binding_1	1218	1235	4.3e-6	PFAM
low complexity region	1429	1444	N/A	INTRINSIC
low complexity region	1479	1501	N/A	INTRINSIC
low complexity region	1601	1612	N/A	INTRINSIC
low complexity region	1738	1768	N/A	INTRINSIC
C1	1773	1819	1.95e-4	SMART
low complexity region	1876	1887	N/A	INTRINSIC
RhoGEF	1979	2171	1.28e-61	SMART
PH	2213	2316	2.94e-11	SMART
coiled coil region	2326	2363	N/A	INTRINSIC
low complexity region	2411	2430	N/A	INTRINSIC
low complexity region	2462	2472	N/A	INTRINSIC
coiled coil region	2551	2664	N/A	INTRINSIC
low complexity region	2746	2752	N/A	INTRINSIC
low complexity region	2758	2771	N/A	INTRINSIC

Predicted Effect

not run
Transcript: ENSMUST00000154740
AA Change: A111S

Predicted Effect

probably benign
Transcript: ENSMUST00000166315
AA Change: A1269S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: A1269S

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207079

Predicted Effect

probably benign
Transcript: ENSMUST00000207750
AA Change: A1269S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

probably benign
Transcript: ENSMUST00000207923
AA Change: A466S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208053

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208182

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208456

Predicted Effect

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Abcc4	G	A	14: 118,553,349	R749C	probably damaging	Het
Acot11	T	C	4: 106,762,035	E201G	probably damaging	Het
Aldh4a1	T	C	4: 139,644,128	V451A	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Asb6	G	A	2: 30,827,076	R46W	probably damaging	Het
Bpifb6	T	C	2: 153,906,861	F259S	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Camk2b	T	C	11: 5,977,880	E390G	probably benign	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc170	T	G	10: 4,519,043	I197S	probably benign	Het
Cdc20b	A	T	13: 113,081,134	K362N	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Cpd	T	C	11: 76,792,798	D1045G	probably benign	Het
Crocc	T	C	4: 141,021,802	D1564G	probably damaging	Het
Csf1r	A	T	18: 61,129,077	M802L	probably damaging	Het
Dctn4	T	C	18: 60,546,335		probably null	Het
Dnah5	A	G	15: 28,313,786	Q1916R	probably damaging	Het
Dpysl2	A	G	14: 66,862,665		probably benign	Het
Dync2h1	A	G	9: 7,081,084	Y2871H	probably damaging	Het
Fam221b	T	A	4: 43,665,537	H307L	probably damaging	Het
Foxn4	C	T	5: 114,263,132	D37N	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm9797	T	C	10: 11,609,325		noncoding transcript	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gper1	C	T	5: 139,426,722	P274L	probably damaging	Het
Gpr132	A	G	12: 112,852,403	S268P	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Hivep1	C	T	13: 42,183,786	A2447V	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Kmt2a	G	A	9: 44,819,675		probably benign	Het
Lhx6	G	T	2: 36,087,458	C327*	probably null	Het
Lifr	A	G	15: 7,181,856	D625G	possibly damaging	Het
Llgl1	T	C	11: 60,707,240	V370A	probably benign	Het
Lman1	A	T	18: 65,991,582	M362K	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lpin3	T	A	2: 160,896,809	L227*	probably null	Het
Ltv1	C	G	10: 13,182,536		probably benign	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mettl17	A	T	14: 51,888,735		probably benign	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Mov10	A	T	3: 104,818,116	I59N	possibly damaging	Het
Myo7b	T	C	18: 31,994,897	I581V	probably benign	Het
Ncdn	T	A	4: 126,745,273		probably null	Het
Ndufa4	A	T	6: 11,900,575	V37E	probably benign	Het
Nhsl1	T	G	10: 18,524,664	L546R	probably benign	Het
Nop9	T	C	14: 55,751,142	L347P	probably damaging	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Ntrk3	G	A	7: 78,477,935		probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr372	A	G	8: 72,058,436	Y252C	probably damaging	Het
Olfr968	A	T	9: 39,772,495	C102S	probably benign	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pknox2	A	G	9: 36,909,684	V294A	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Ptgdr	A	T	14: 44,858,579	Y225*	probably null	Het
Ptpn22	A	G	3: 103,874,052	I90V	probably damaging	Het
Pygb	C	T	2: 150,816,772	T372I	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Qrich2	C	T	11: 116,441,449	G2307D	probably damaging	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Slfn9	T	A	11: 82,981,307	I868F	probably damaging	Het
St3gal6	T	C	16: 58,475,871	D137G	probably damaging	Het
Synj1	G	T	16: 90,964,517	A687D	probably damaging	Het
Syt4	A	G	18: 31,443,443		probably benign	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tmem200a	T	A	10: 25,993,927	H148L	probably damaging	Het
Trappc8	A	G	18: 20,834,940		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ubr4	T	A	4: 139,423,945	M1897K	probably damaging	Het
Uggt2	A	G	14: 119,061,376	L391P	probably damaging	Het
Uncx	T	C	5: 139,547,547	S456P	probably benign	Het
Vps13b	A	G	15: 35,879,791	Y3004C	probably damaging	Het
Wisp1	G	A	15: 66,906,489	C53Y	probably damaging	Het
Zbtb46	C	T	2: 181,391,431	C479Y	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp503	A	T	14: 21,985,520	C443S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7069:Akap13	UTSW	7	75610262	missense	probably benign	0.29
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7834:Akap13	UTSW	7	75742642	missense	possibly damaging	0.85
R7880:Akap13	UTSW	7	75586216	missense	probably damaging	0.97
R7942:Akap13	UTSW	7	75611470	missense	possibly damaging	0.50
R8006:Akap13	UTSW	7	75579696	missense	probably damaging	1.00
R8009:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8011:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8012:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8013:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8016:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8089:Akap13	UTSW	7	75610592	missense	possibly damaging	0.94
R8138:Akap13	UTSW	7	75702231	splice site	probably null
R8174:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R8298:Akap13	UTSW	7	75747804	missense	probably damaging	1.00
R8444:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8445:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8465:Akap13	UTSW	7	75727038	missense	probably benign	0.11
R8512:Akap13	UTSW	7	75611086	missense	probably damaging	0.99
R8523:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8793:Akap13	UTSW	7	75725328	missense	probably benign	0.35
R8907:Akap13	UTSW	7	75610696	missense	probably benign	0.08
R8907:Akap13	UTSW	7	75610708	missense	probably damaging	0.99
R8928:Akap13	UTSW	7	75609858	missense	probably benign	0.00
R8929:Akap13	UTSW	7	75609004	missense	probably benign	0.00
R8937:Akap13	UTSW	7	75534853	critical splice donor site	probably null
R8967:Akap13	UTSW	7	75729134	missense	possibly damaging	0.80
R8986:Akap13	UTSW	7	75609326	missense	probably benign
R9152:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R9153:Akap13	UTSW	7	75609481	missense	probably benign	0.00
R9160:Akap13	UTSW	7	75735778	missense	possibly damaging	0.88
R9192:Akap13	UTSW	7	75704501	missense	probably benign	0.06
R9319:Akap13	UTSW	7	75609088	missense	probably benign	0.01
R9513:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9515:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9516:Akap13	UTSW	7	75704527	missense	probably benign	0.01
R9523:Akap13	UTSW	7	75643445	missense
R9564:Akap13	UTSW	7	75609413	missense	probably benign
R9621:Akap13	UTSW	7	75736342	missense	probably benign	0.09
R9686:Akap13	UTSW	7	75586336	missense	probably damaging	1.00
Z1176:Akap13	UTSW	7	75730552	missense	probably damaging	0.99
Z1177:Akap13	UTSW	7	75615005	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ATGTGCCTACCAGAGCAGACTC -3'
(R):5'- TTGGCAACTTACATGACTGAGC -3'

Sequencing Primer
(F):5'- TACCAGAGCAGACTCCATAGAGG -3'
(R):5'- TTACATGACTGAGCAAGTAGGACTAC -3'

Posted On

2014-06-23