Incidental Mutation 'R1786:Akap13'
ID 202812
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase anchor protein 13
Synonyms PROTO-LB, Ht31, 5830460E08Rik, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, AKAP-Lbc
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 75105282-75404357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 75261182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1269 (A1269S)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000147005
AA Change: A1269S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: A1269S

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000154740
AA Change: A111S
Predicted Effect probably benign
Transcript: ENSMUST00000166315
AA Change: A1269S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: A1269S

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207079
Predicted Effect probably benign
Transcript: ENSMUST00000207750
AA Change: A1269S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000207923
AA Change: A466S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208456
Predicted Effect
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,375,719 (GRCm39) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,378,667 (GRCm39) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,373,643 (GRCm39) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,260,417 (GRCm39) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,354,146 (GRCm39) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,354,260 (GRCm39) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,259,475 (GRCm39) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,327,195 (GRCm39) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,400,381 (GRCm39) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,316,279 (GRCm39) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,219,684 (GRCm39) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,375,096 (GRCm39) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,252,595 (GRCm39) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,397,594 (GRCm39) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,258,270 (GRCm39) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,397,353 (GRCm39) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,369,928 (GRCm39) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,347,141 (GRCm39) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,219,767 (GRCm39) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,396,515 (GRCm39) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,316,293 (GRCm39) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,252,659 (GRCm39) missense probably benign
IGL02421:Akap13 APN 7 75,367,554 (GRCm39) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,258,936 (GRCm39) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,258,405 (GRCm39) missense probably benign
IGL03051:Akap13 APN 7 75,260,233 (GRCm39) nonsense probably null
IGL03160:Akap13 APN 7 75,380,165 (GRCm39) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,259,500 (GRCm39) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,386,352 (GRCm39) splice site probably benign
R0310:Akap13 UTSW 7 75,264,678 (GRCm39) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,380,248 (GRCm39) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,259,677 (GRCm39) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,396,544 (GRCm39) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,264,744 (GRCm39) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,397,494 (GRCm39) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,375,128 (GRCm39) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,337,034 (GRCm39) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,327,157 (GRCm39) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,235,941 (GRCm39) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,385,526 (GRCm39) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,326,942 (GRCm39) missense probably damaging 1.00
R1773:Akap13 UTSW 7 75,333,199 (GRCm39) missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,260,783 (GRCm39) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,258,453 (GRCm39) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,260,475 (GRCm39) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,354,264 (GRCm39) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,354,279 (GRCm39) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,260,318 (GRCm39) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,375,052 (GRCm39) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,389,225 (GRCm39) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,316,298 (GRCm39) missense probably damaging 1.00
R3713:Akap13 UTSW 7 75,235,929 (GRCm39) missense probably damaging 0.98
R3731:Akap13 UTSW 7 75,261,125 (GRCm39) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,258,585 (GRCm39) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,351,901 (GRCm39) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,259,889 (GRCm39) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,219,699 (GRCm39) nonsense probably null
R4205:Akap13 UTSW 7 75,260,667 (GRCm39) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,258,732 (GRCm39) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,252,521 (GRCm39) splice site probably null
R4632:Akap13 UTSW 7 75,316,301 (GRCm39) missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4669:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,229,312 (GRCm39) nonsense probably null
R4821:Akap13 UTSW 7 75,327,255 (GRCm39) intron probably benign
R4868:Akap13 UTSW 7 75,393,252 (GRCm39) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,375,068 (GRCm39) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,398,988 (GRCm39) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,399,178 (GRCm39) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,380,276 (GRCm39) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,337,000 (GRCm39) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,259,362 (GRCm39) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,259,991 (GRCm39) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,252,652 (GRCm39) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,252,578 (GRCm39) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,236,049 (GRCm39) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,354,120 (GRCm39) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,351,902 (GRCm39) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,378,894 (GRCm39) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,259,932 (GRCm39) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,259,656 (GRCm39) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,327,164 (GRCm39) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,236,028 (GRCm39) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,398,941 (GRCm39) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,335,002 (GRCm39) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,376,792 (GRCm39) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,229,516 (GRCm39) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,380,111 (GRCm39) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,219,729 (GRCm39) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,252,646 (GRCm39) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,389,206 (GRCm39) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,260,010 (GRCm39) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,369,943 (GRCm39) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,229,342 (GRCm39) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,380,327 (GRCm39) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,398,995 (GRCm39) missense probably benign
R7636:Akap13 UTSW 7 75,259,621 (GRCm39) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,293,202 (GRCm39) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,219,648 (GRCm39) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,378,544 (GRCm39) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,327,006 (GRCm39) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,260,076 (GRCm39) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,392,390 (GRCm39) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,235,964 (GRCm39) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,261,218 (GRCm39) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,229,444 (GRCm39) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,260,340 (GRCm39) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,351,979 (GRCm39) splice site probably null
R8174:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,397,552 (GRCm39) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8465:Akap13 UTSW 7 75,376,786 (GRCm39) missense probably benign 0.11
R8512:Akap13 UTSW 7 75,260,834 (GRCm39) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,375,076 (GRCm39) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,260,456 (GRCm39) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,260,444 (GRCm39) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,259,606 (GRCm39) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,258,752 (GRCm39) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,184,601 (GRCm39) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,378,882 (GRCm39) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,259,074 (GRCm39) missense probably benign
R9152:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,259,229 (GRCm39) missense probably benign 0.00
R9160:Akap13 UTSW 7 75,385,526 (GRCm39) missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75,354,249 (GRCm39) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,258,836 (GRCm39) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,293,193 (GRCm39) missense
R9564:Akap13 UTSW 7 75,259,161 (GRCm39) missense probably benign
R9621:Akap13 UTSW 7 75,386,090 (GRCm39) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,236,084 (GRCm39) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,380,300 (GRCm39) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,264,753 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGTGCCTACCAGAGCAGACTC -3'
(R):5'- TTGGCAACTTACATGACTGAGC -3'

Sequencing Primer
(F):5'- TACCAGAGCAGACTCCATAGAGG -3'
(R):5'- TTACATGACTGAGCAAGTAGGACTAC -3'
Posted On 2014-06-23