Mutagenetix > Incidental Mutation

Incidental Mutation 'R1786:Ntrk3'

202813

Institutional Source

Beutler Lab

Gene Symbol

Ntrk3

Ensembl Gene

ENSMUSG00000059146

Gene Name

neurotrophic tyrosine kinase, receptor, type 3

Synonyms

TrkC

MMRRC Submission

039817-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1786 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78175959-78738012 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 78477935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]

AlphaFold

Q6VNS1

Predicted Effect

probably benign
Transcript: ENSMUST00000039431

SMART Domains

Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	810	1.49e-145	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000039438

SMART Domains

Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	3.1e-8	PFAM
transmembrane domain	429	451	N/A	INTRINSIC
PDB:2MFQ\|B	497	517	2e-6	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155795

Predicted Effect

probably benign
Transcript: ENSMUST00000193002

SMART Domains

Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
Pfam:Ig_2	312	392	6.9e-4	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	824	4.29e-137	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195262

SMART Domains

Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

Domain	Start	End	E-Value	Type
LRRNT	31	63	1.2e-6	SMART
LRRCT	160	208	1.8e-14	SMART
IG	216	302	5.1e-11	SMART
Pfam:I-set	308	392	4.7e-7	PFAM
Pfam:Ig_2	312	392	1.3e-2	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	849	9.7e-132	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206167

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Abcc4	G	A	14: 118,553,349	R749C	probably damaging	Het
Acot11	T	C	4: 106,762,035	E201G	probably damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Aldh4a1	T	C	4: 139,644,128	V451A	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Asb6	G	A	2: 30,827,076	R46W	probably damaging	Het
Bpifb6	T	C	2: 153,906,861	F259S	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Camk2b	T	C	11: 5,977,880	E390G	probably benign	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc170	T	G	10: 4,519,043	I197S	probably benign	Het
Cdc20b	A	T	13: 113,081,134	K362N	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Cpd	T	C	11: 76,792,798	D1045G	probably benign	Het
Crocc	T	C	4: 141,021,802	D1564G	probably damaging	Het
Csf1r	A	T	18: 61,129,077	M802L	probably damaging	Het
Dctn4	T	C	18: 60,546,335		probably null	Het
Dnah5	A	G	15: 28,313,786	Q1916R	probably damaging	Het
Dpysl2	A	G	14: 66,862,665		probably benign	Het
Dync2h1	A	G	9: 7,081,084	Y2871H	probably damaging	Het
Fam221b	T	A	4: 43,665,537	H307L	probably damaging	Het
Foxn4	C	T	5: 114,263,132	D37N	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm9797	T	C	10: 11,609,325		noncoding transcript	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gper1	C	T	5: 139,426,722	P274L	probably damaging	Het
Gpr132	A	G	12: 112,852,403	S268P	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Hivep1	C	T	13: 42,183,786	A2447V	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Kmt2a	G	A	9: 44,819,675		probably benign	Het
Lhx6	G	T	2: 36,087,458	C327*	probably null	Het
Lifr	A	G	15: 7,181,856	D625G	possibly damaging	Het
Llgl1	T	C	11: 60,707,240	V370A	probably benign	Het
Lman1	A	T	18: 65,991,582	M362K	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lpin3	T	A	2: 160,896,809	L227*	probably null	Het
Ltv1	C	G	10: 13,182,536		probably benign	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mettl17	A	T	14: 51,888,735		probably benign	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Mov10	A	T	3: 104,818,116	I59N	possibly damaging	Het
Myo7b	T	C	18: 31,994,897	I581V	probably benign	Het
Ncdn	T	A	4: 126,745,273		probably null	Het
Ndufa4	A	T	6: 11,900,575	V37E	probably benign	Het
Nhsl1	T	G	10: 18,524,664	L546R	probably benign	Het
Nop9	T	C	14: 55,751,142	L347P	probably damaging	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr372	A	G	8: 72,058,436	Y252C	probably damaging	Het
Olfr968	A	T	9: 39,772,495	C102S	probably benign	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pknox2	A	G	9: 36,909,684	V294A	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Ptgdr	A	T	14: 44,858,579	Y225*	probably null	Het
Ptpn22	A	G	3: 103,874,052	I90V	probably damaging	Het
Pygb	C	T	2: 150,816,772	T372I	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Qrich2	C	T	11: 116,441,449	G2307D	probably damaging	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Slfn9	T	A	11: 82,981,307	I868F	probably damaging	Het
St3gal6	T	C	16: 58,475,871	D137G	probably damaging	Het
Synj1	G	T	16: 90,964,517	A687D	probably damaging	Het
Syt4	A	G	18: 31,443,443		probably benign	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tmem200a	T	A	10: 25,993,927	H148L	probably damaging	Het
Trappc8	A	G	18: 20,834,940		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ubr4	T	A	4: 139,423,945	M1897K	probably damaging	Het
Uggt2	A	G	14: 119,061,376	L391P	probably damaging	Het
Uncx	T	C	5: 139,547,547	S456P	probably benign	Het
Vps13b	A	G	15: 35,879,791	Y3004C	probably damaging	Het
Wisp1	G	A	15: 66,906,489	C53Y	probably damaging	Het
Zbtb46	C	T	2: 181,391,431	C479Y	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp503	A	T	14: 21,985,520	C443S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in Ntrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Ntrk3	APN	7	78250873	missense	probably benign	0.03
IGL00862:Ntrk3	APN	7	78247177	missense	probably damaging	1.00
IGL00972:Ntrk3	APN	7	78247322	missense	possibly damaging	0.95
IGL00976:Ntrk3	APN	7	78450953	missense	probably benign	0.02
IGL02172:Ntrk3	APN	7	78460272	splice site	probably benign
IGL02175:Ntrk3	APN	7	78247228	missense	probably damaging	1.00
IGL02213:Ntrk3	APN	7	78462931	missense	probably benign	0.17
IGL02363:Ntrk3	APN	7	78453337	missense	probably benign	0.24
IGL02527:Ntrk3	APN	7	78451949	missense	probably benign
IGL02673:Ntrk3	APN	7	78250764	missense	probably damaging	1.00
IGL02755:Ntrk3	APN	7	78460439	missense	probably benign
IGL02998:Ntrk3	APN	7	78577657	missense	probably damaging	0.98
IGL03235:Ntrk3	APN	7	78192592	missense	probably damaging	1.00
R1465:Ntrk3	UTSW	7	78356014	splice site	probably benign
R1505:Ntrk3	UTSW	7	78460524	missense	probably damaging	0.99
R1638:Ntrk3	UTSW	7	78247288	missense	probably damaging	1.00
R1641:Ntrk3	UTSW	7	78356074	missense	probably damaging	1.00
R1775:Ntrk3	UTSW	7	78356041	missense	possibly damaging	0.60
R1827:Ntrk3	UTSW	7	78247301	missense	probably damaging	1.00
R1868:Ntrk3	UTSW	7	78192604	missense	possibly damaging	0.90
R1873:Ntrk3	UTSW	7	78462839	missense	probably benign
R1929:Ntrk3	UTSW	7	78516723	splice site	probably null
R1941:Ntrk3	UTSW	7	78247262	missense	probably damaging	1.00
R2132:Ntrk3	UTSW	7	78477935	splice site	probably benign
R2214:Ntrk3	UTSW	7	78516772	missense	probably damaging	1.00
R2221:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2223:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2271:Ntrk3	UTSW	7	78516723	splice site	probably null
R2441:Ntrk3	UTSW	7	78302662	missense	probably damaging	1.00
R3108:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3109:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3959:Ntrk3	UTSW	7	78198842	missense	probably damaging	1.00
R4016:Ntrk3	UTSW	7	78462947	splice site	probably benign
R4028:Ntrk3	UTSW	7	78192710	missense	probably damaging	1.00
R4067:Ntrk3	UTSW	7	78517437	missense	probably damaging	1.00
R4398:Ntrk3	UTSW	7	78250769	nonsense	probably null
R4664:Ntrk3	UTSW	7	78461099	missense	probably damaging	0.99
R5045:Ntrk3	UTSW	7	78460424	missense	probably benign	0.13
R5081:Ntrk3	UTSW	7	78577774	missense	probably damaging	0.99
R5151:Ntrk3	UTSW	7	78247300	missense	probably damaging	1.00
R5249:Ntrk3	UTSW	7	78461166	missense	possibly damaging	0.87
R5294:Ntrk3	UTSW	7	78517506	splice site	probably null
R5594:Ntrk3	UTSW	7	78451899	missense	probably benign	0.10
R5923:Ntrk3	UTSW	7	78451928	missense	possibly damaging	0.61
R6878:Ntrk3	UTSW	7	78304372	missense	probably benign	0.00
R7083:Ntrk3	UTSW	7	78250839	missense	probably damaging	1.00
R7178:Ntrk3	UTSW	7	78356147	missense	possibly damaging	0.86
R7487:Ntrk3	UTSW	7	78250713	missense	probably damaging	1.00
R7607:Ntrk3	UTSW	7	78250873	missense	probably benign	0.03
R7800:Ntrk3	UTSW	7	78302740	missense	probably benign	0.09
R7961:Ntrk3	UTSW	7	78453328	missense	probably benign
R7976:Ntrk3	UTSW	7	78356206	missense	probably damaging	0.97
R8009:Ntrk3	UTSW	7	78453328	missense	probably benign
R8032:Ntrk3	UTSW	7	78356059	missense	probably damaging	1.00
R8104:Ntrk3	UTSW	7	78577702	missense	probably damaging	0.99
R8230:Ntrk3	UTSW	7	78250770	missense	probably damaging	1.00
R8254:Ntrk3	UTSW	7	78192578	missense	probably damaging	1.00
R8412:Ntrk3	UTSW	7	78356149	missense	probably benign	0.02
R8465:Ntrk3	UTSW	7	78462883	missense	probably damaging	0.99
R8841:Ntrk3	UTSW	7	78356093	missense	probably damaging	0.99
R9187:Ntrk3	UTSW	7	78247218	missense	possibly damaging	0.93
R9444:Ntrk3	UTSW	7	78461057	missense	probably damaging	1.00
R9475:Ntrk3	UTSW	7	78302732	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- ATGCTCAATGCTCTCCAACC -3'
(R):5'- GGTCTCAACTGTTAGCAGAAAC -3'

Sequencing Primer
(F):5'- GCTCAATGCTCTCCAACCCAAAC -3'
(R):5'- GTTAGCAGAAACACCATTAGCAATG -3'

Posted On

2014-06-23