Incidental Mutation 'R1786:Tacc1'
ID 202817
Institutional Source Beutler Lab
Gene Symbol Tacc1
Ensembl Gene ENSMUSG00000065954
Gene Name transforming, acidic coiled-coil containing protein 1
Synonyms 4833447E04Rik, B230378H13Rik, Tacc1
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.310) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 25644568-25730901 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25654509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 271 (N271K)
Ref Sequence ENSEMBL: ENSMUSP00000081560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084030] [ENSMUST00000084512] [ENSMUST00000210016] [ENSMUST00000210933] [ENSMUST00000211622]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000084030
AA Change: N679K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081043
Gene: ENSMUSG00000065954
AA Change: N679K

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
Pfam:TACC 569 769 3.6e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084512
AA Change: N271K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081560
Gene: ENSMUSG00000065954
AA Change: N271K

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
Pfam:TACC 160 366 3.5e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209441
Predicted Effect probably benign
Transcript: ENSMUST00000210016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210645
Predicted Effect probably benign
Transcript: ENSMUST00000210933
Predicted Effect probably benign
Transcript: ENSMUST00000211622
Meta Mutation Damage Score 0.8997 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus may represent a breast cancer candidate gene. It is located close to FGFR1 on a region of chromosome 8 that is amplified in some breast cancers. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Tacc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Tacc1 APN 8 25,665,233 (GRCm39) missense probably damaging 1.00
IGL02273:Tacc1 APN 8 25,649,797 (GRCm39) missense probably damaging 1.00
IGL02728:Tacc1 APN 8 25,665,235 (GRCm39) missense probably damaging 1.00
IGL02738:Tacc1 APN 8 25,691,159 (GRCm39) missense probably damaging 1.00
R0194:Tacc1 UTSW 8 25,672,392 (GRCm39) missense probably benign 0.45
R0617:Tacc1 UTSW 8 25,668,020 (GRCm39) splice site probably benign
R1469:Tacc1 UTSW 8 25,672,271 (GRCm39) missense probably benign 0.00
R1469:Tacc1 UTSW 8 25,672,271 (GRCm39) missense probably benign 0.00
R1785:Tacc1 UTSW 8 25,654,509 (GRCm39) missense probably damaging 1.00
R1889:Tacc1 UTSW 8 25,665,269 (GRCm39) missense probably damaging 0.99
R2131:Tacc1 UTSW 8 25,654,509 (GRCm39) missense probably damaging 1.00
R2133:Tacc1 UTSW 8 25,654,509 (GRCm39) missense probably damaging 1.00
R2419:Tacc1 UTSW 8 25,672,829 (GRCm39) missense possibly damaging 0.90
R4740:Tacc1 UTSW 8 25,672,581 (GRCm39) missense possibly damaging 0.94
R4793:Tacc1 UTSW 8 25,672,405 (GRCm39) missense possibly damaging 0.96
R4911:Tacc1 UTSW 8 25,672,622 (GRCm39) missense possibly damaging 0.66
R5177:Tacc1 UTSW 8 25,691,237 (GRCm39) missense probably damaging 1.00
R5320:Tacc1 UTSW 8 25,671,881 (GRCm39) missense probably benign 0.31
R5377:Tacc1 UTSW 8 25,672,299 (GRCm39) missense possibly damaging 0.94
R5452:Tacc1 UTSW 8 25,654,431 (GRCm39) missense probably null 1.00
R5930:Tacc1 UTSW 8 25,672,215 (GRCm39) missense probably benign
R5952:Tacc1 UTSW 8 25,672,011 (GRCm39) missense possibly damaging 0.85
R6767:Tacc1 UTSW 8 25,730,816 (GRCm39) start codon destroyed probably null
R7200:Tacc1 UTSW 8 25,731,656 (GRCm39) unclassified probably benign
R7464:Tacc1 UTSW 8 25,654,480 (GRCm39) missense probably damaging 1.00
R7521:Tacc1 UTSW 8 25,665,268 (GRCm39) missense possibly damaging 0.82
R7599:Tacc1 UTSW 8 25,691,301 (GRCm39) start codon destroyed probably damaging 1.00
R8050:Tacc1 UTSW 8 25,659,230 (GRCm39) missense probably benign 0.12
R8205:Tacc1 UTSW 8 25,672,803 (GRCm39) missense probably benign 0.03
R8377:Tacc1 UTSW 8 25,672,299 (GRCm39) missense possibly damaging 0.68
R8418:Tacc1 UTSW 8 25,731,532 (GRCm39) missense probably damaging 1.00
R8780:Tacc1 UTSW 8 25,672,077 (GRCm39) missense probably benign 0.00
R9120:Tacc1 UTSW 8 25,659,255 (GRCm39) missense probably damaging 1.00
R9121:Tacc1 UTSW 8 25,659,255 (GRCm39) missense probably damaging 1.00
R9122:Tacc1 UTSW 8 25,659,255 (GRCm39) missense probably damaging 1.00
R9132:Tacc1 UTSW 8 25,672,151 (GRCm39) missense possibly damaging 0.71
R9238:Tacc1 UTSW 8 25,672,634 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACGCAACTTTGTAGATCCAAGTG -3'
(R):5'- CAGTGGGGTTGCATAAGCTG -3'

Sequencing Primer
(F):5'- GCAACTTTGTAGATCCAAGTGTCTGC -3'
(R):5'- GCATAAGCTGTTGAAATTGCCG -3'
Posted On 2014-06-23