Incidental Mutation 'R1786:Zfp280d'
ID 202825
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Name zinc finger protein 280D
Synonyms Suhw4
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.245) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 72182142-72271059 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72215287 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 133 (F133L)
Ref Sequence ENSEMBL: ENSMUSP00000138857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
AlphaFold Q68FE8
Predicted Effect probably damaging
Transcript: ENSMUST00000098576
AA Change: F158L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: F158L

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183410
AA Change: F158L

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: F158L

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183608
Predicted Effect probably benign
Transcript: ENSMUST00000183801
AA Change: F158L

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535
AA Change: F158L

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184036
AA Change: F133L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535
AA Change: F133L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184248
Predicted Effect probably benign
Transcript: ENSMUST00000184399
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184517
AA Change: F158L

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: F158L

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184786
AA Change: F128L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000185020
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72,229,853 (GRCm39) missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72,219,417 (GRCm39) missense probably benign 0.19
IGL01333:Zfp280d APN 9 72,242,396 (GRCm39) splice site probably benign
IGL01453:Zfp280d APN 9 72,229,868 (GRCm39) missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72,208,993 (GRCm39) missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72,229,727 (GRCm39) splice site probably benign
IGL02608:Zfp280d APN 9 72,215,261 (GRCm39) missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72,219,504 (GRCm39) missense probably benign 0.33
IGL02676:Zfp280d APN 9 72,242,356 (GRCm39) missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72,203,307 (GRCm39) missense probably benign 0.02
IGL03076:Zfp280d APN 9 72,219,944 (GRCm39) missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72,246,292 (GRCm39) critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72,246,292 (GRCm39) critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72,238,621 (GRCm39) nonsense probably null
R0419:Zfp280d UTSW 9 72,219,519 (GRCm39) missense probably benign 0.02
R0540:Zfp280d UTSW 9 72,215,247 (GRCm39) missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72,269,230 (GRCm39) missense probably benign
R0722:Zfp280d UTSW 9 72,219,383 (GRCm39) missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72,236,449 (GRCm39) splice site probably null
R1826:Zfp280d UTSW 9 72,206,062 (GRCm39) missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72,242,362 (GRCm39) nonsense probably null
R2130:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72,215,287 (GRCm39) missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72,220,011 (GRCm39) missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72,206,104 (GRCm39) missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72,209,052 (GRCm39) splice site probably benign
R2269:Zfp280d UTSW 9 72,209,052 (GRCm39) splice site probably benign
R2278:Zfp280d UTSW 9 72,246,055 (GRCm39) nonsense probably null
R2850:Zfp280d UTSW 9 72,219,371 (GRCm39) missense probably benign 0.06
R3780:Zfp280d UTSW 9 72,229,806 (GRCm39) missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72,203,301 (GRCm39) missense possibly damaging 0.49
R4330:Zfp280d UTSW 9 72,203,261 (GRCm39) missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72,219,947 (GRCm39) missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72,206,140 (GRCm39) splice site probably benign
R4909:Zfp280d UTSW 9 72,238,714 (GRCm39) missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72,215,395 (GRCm39) unclassified probably benign
R5518:Zfp280d UTSW 9 72,231,417 (GRCm39) missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72,238,224 (GRCm39) missense probably benign 0.20
R5945:Zfp280d UTSW 9 72,269,614 (GRCm39) nonsense probably null
R6033:Zfp280d UTSW 9 72,236,419 (GRCm39) missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72,236,419 (GRCm39) missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72,226,539 (GRCm39) missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72,269,224 (GRCm39) missense possibly damaging 0.65
R7658:Zfp280d UTSW 9 72,231,354 (GRCm39) missense probably damaging 1.00
R7667:Zfp280d UTSW 9 72,209,247 (GRCm39) missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72,238,601 (GRCm39) missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72,219,953 (GRCm39) missense possibly damaging 0.68
R7964:Zfp280d UTSW 9 72,229,740 (GRCm39) missense probably damaging 1.00
R8096:Zfp280d UTSW 9 72,226,560 (GRCm39) missense probably damaging 1.00
R8188:Zfp280d UTSW 9 72,267,615 (GRCm39) missense probably benign 0.01
R9210:Zfp280d UTSW 9 72,269,789 (GRCm39) makesense probably null
R9212:Zfp280d UTSW 9 72,269,789 (GRCm39) makesense probably null
R9435:Zfp280d UTSW 9 72,226,599 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATCAGTTTTAGTTGGGCAAATCG -3'
(R):5'- GCATTTTAAAGGTTGGTTCCATAGG -3'

Sequencing Primer
(F):5'- TCGGAACAAACAAGCTCTATTTGC -3'
(R):5'- GGTTGGTTCCATAGGAAAAAGAATAC -3'
Posted On 2014-06-23