Incidental Mutation 'R1786:Tjp3'
ID 202831
Institutional Source Beutler Lab
Gene Symbol Tjp3
Ensembl Gene ENSMUSG00000034917
Gene Name tight junction protein 3
Synonyms ZO-3
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1786 (G1)
Quality Score 216
Status Validated
Chromosome 10
Chromosomal Location 81109041-81127415 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 81113888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 457 (M457L)
Ref Sequence ENSEMBL: ENSMUSP00000151601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000057798] [ENSMUST00000218484] [ENSMUST00000219479] [ENSMUST00000220297]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000045744
AA Change: M457L

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917
AA Change: M457L

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000057798
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218146
Predicted Effect probably benign
Transcript: ENSMUST00000218297
Predicted Effect probably benign
Transcript: ENSMUST00000218484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218966
Predicted Effect possibly damaging
Transcript: ENSMUST00000219479
AA Change: M457L

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219958
Predicted Effect probably benign
Transcript: ENSMUST00000220297
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutation of this gene results in viable and fertile mice with no abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Tjp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tjp3 APN 10 81,109,699 (GRCm39) missense probably benign
IGL01739:Tjp3 APN 10 81,114,490 (GRCm39) missense probably benign 0.09
IGL02826:Tjp3 APN 10 81,109,523 (GRCm39) missense probably damaging 0.98
IGL03145:Tjp3 APN 10 81,119,522 (GRCm39) missense probably benign 0.05
PIT4480001:Tjp3 UTSW 10 81,115,091 (GRCm39) missense probably damaging 1.00
R0561:Tjp3 UTSW 10 81,109,674 (GRCm39) missense probably benign
R0562:Tjp3 UTSW 10 81,116,389 (GRCm39) missense probably damaging 0.99
R1099:Tjp3 UTSW 10 81,109,657 (GRCm39) missense probably benign
R1618:Tjp3 UTSW 10 81,112,094 (GRCm39) unclassified probably benign
R1955:Tjp3 UTSW 10 81,113,833 (GRCm39) missense probably damaging 1.00
R2107:Tjp3 UTSW 10 81,116,378 (GRCm39) missense possibly damaging 0.67
R2130:Tjp3 UTSW 10 81,113,888 (GRCm39) missense possibly damaging 0.52
R2131:Tjp3 UTSW 10 81,113,888 (GRCm39) missense possibly damaging 0.52
R2132:Tjp3 UTSW 10 81,113,888 (GRCm39) missense possibly damaging 0.52
R2133:Tjp3 UTSW 10 81,113,888 (GRCm39) missense possibly damaging 0.52
R2178:Tjp3 UTSW 10 81,115,941 (GRCm39) missense probably benign 0.17
R3054:Tjp3 UTSW 10 81,116,341 (GRCm39) missense probably benign 0.13
R3055:Tjp3 UTSW 10 81,116,341 (GRCm39) missense probably benign 0.13
R5470:Tjp3 UTSW 10 81,115,381 (GRCm39) missense probably benign 0.04
R5645:Tjp3 UTSW 10 81,114,454 (GRCm39) splice site probably null
R5918:Tjp3 UTSW 10 81,113,746 (GRCm39) missense probably benign 0.01
R6108:Tjp3 UTSW 10 81,116,980 (GRCm39) missense probably benign
R6245:Tjp3 UTSW 10 81,113,110 (GRCm39) missense probably benign 0.02
R6300:Tjp3 UTSW 10 81,116,951 (GRCm39) nonsense probably null
R7686:Tjp3 UTSW 10 81,113,885 (GRCm39) missense probably benign 0.00
R7958:Tjp3 UTSW 10 81,118,828 (GRCm39) missense possibly damaging 0.56
R8137:Tjp3 UTSW 10 81,109,525 (GRCm39) missense probably benign 0.00
R8240:Tjp3 UTSW 10 81,109,641 (GRCm39) missense probably benign 0.06
R8317:Tjp3 UTSW 10 81,116,324 (GRCm39) missense probably benign 0.11
R9226:Tjp3 UTSW 10 81,110,420 (GRCm39) missense probably damaging 1.00
R9548:Tjp3 UTSW 10 81,113,833 (GRCm39) missense probably damaging 1.00
R9610:Tjp3 UTSW 10 81,119,411 (GRCm39) missense possibly damaging 0.57
R9611:Tjp3 UTSW 10 81,119,411 (GRCm39) missense possibly damaging 0.57
R9682:Tjp3 UTSW 10 81,109,645 (GRCm39) missense probably benign 0.09
R9790:Tjp3 UTSW 10 81,109,694 (GRCm39) missense probably benign 0.00
R9791:Tjp3 UTSW 10 81,109,694 (GRCm39) missense probably benign 0.00
Z1176:Tjp3 UTSW 10 81,116,943 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAGCAATGGGAATGGTG -3'
(R):5'- TATTTACAGAGACCCGAGGTGG -3'

Sequencing Primer
(F):5'- ATGACGCCGCGTTCTTG -3'
(R):5'- TAATCATCGCACTCAGGTGG -3'
Posted On 2014-06-23