Mutagenetix > Incidental Mutation

Incidental Mutation 'R1786:Llgl1'

202836

Institutional Source

Beutler Lab

Gene Symbol

Llgl1

Ensembl Gene

ENSMUSG00000020536

Gene Name

LLGL1 scribble cell polarity complex component

Synonyms

Lgl1

MMRRC Submission

039817-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1786 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60699723-60714186 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60707240 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 370 (V370A)

Ref Sequence

ENSEMBL: ENSMUSP00000104359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052346] [ENSMUST00000108719]

AlphaFold

Q80Y17

Predicted Effect

probably benign
Transcript: ENSMUST00000052346
AA Change: V370A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: V370A

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	278	379	1.2e-43	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	541	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	732	978	1.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108719
AA Change: V370A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: V370A

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	275	379	2e-48	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	540	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	804	976	1.3e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128749

Meta Mutation Damage Score

0.0885

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Abcc4	G	A	14: 118,553,349	R749C	probably damaging	Het
Acot11	T	C	4: 106,762,035	E201G	probably damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Aldh4a1	T	C	4: 139,644,128	V451A	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Asb6	G	A	2: 30,827,076	R46W	probably damaging	Het
Bpifb6	T	C	2: 153,906,861	F259S	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Camk2b	T	C	11: 5,977,880	E390G	probably benign	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc170	T	G	10: 4,519,043	I197S	probably benign	Het
Cdc20b	A	T	13: 113,081,134	K362N	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Cpd	T	C	11: 76,792,798	D1045G	probably benign	Het
Crocc	T	C	4: 141,021,802	D1564G	probably damaging	Het
Csf1r	A	T	18: 61,129,077	M802L	probably damaging	Het
Dctn4	T	C	18: 60,546,335		probably null	Het
Dnah5	A	G	15: 28,313,786	Q1916R	probably damaging	Het
Dpysl2	A	G	14: 66,862,665		probably benign	Het
Dync2h1	A	G	9: 7,081,084	Y2871H	probably damaging	Het
Fam221b	T	A	4: 43,665,537	H307L	probably damaging	Het
Foxn4	C	T	5: 114,263,132	D37N	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm9797	T	C	10: 11,609,325		noncoding transcript	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gper1	C	T	5: 139,426,722	P274L	probably damaging	Het
Gpr132	A	G	12: 112,852,403	S268P	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Hivep1	C	T	13: 42,183,786	A2447V	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Kmt2a	G	A	9: 44,819,675		probably benign	Het
Lhx6	G	T	2: 36,087,458	C327*	probably null	Het
Lifr	A	G	15: 7,181,856	D625G	possibly damaging	Het
Lman1	A	T	18: 65,991,582	M362K	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lpin3	T	A	2: 160,896,809	L227*	probably null	Het
Ltv1	C	G	10: 13,182,536		probably benign	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mettl17	A	T	14: 51,888,735		probably benign	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Mov10	A	T	3: 104,818,116	I59N	possibly damaging	Het
Myo7b	T	C	18: 31,994,897	I581V	probably benign	Het
Ncdn	T	A	4: 126,745,273		probably null	Het
Ndufa4	A	T	6: 11,900,575	V37E	probably benign	Het
Nhsl1	T	G	10: 18,524,664	L546R	probably benign	Het
Nop9	T	C	14: 55,751,142	L347P	probably damaging	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Ntrk3	G	A	7: 78,477,935		probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr372	A	G	8: 72,058,436	Y252C	probably damaging	Het
Olfr968	A	T	9: 39,772,495	C102S	probably benign	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pknox2	A	G	9: 36,909,684	V294A	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Ptgdr	A	T	14: 44,858,579	Y225*	probably null	Het
Ptpn22	A	G	3: 103,874,052	I90V	probably damaging	Het
Pygb	C	T	2: 150,816,772	T372I	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Qrich2	C	T	11: 116,441,449	G2307D	probably damaging	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Slfn9	T	A	11: 82,981,307	I868F	probably damaging	Het
St3gal6	T	C	16: 58,475,871	D137G	probably damaging	Het
Synj1	G	T	16: 90,964,517	A687D	probably damaging	Het
Syt4	A	G	18: 31,443,443		probably benign	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tmem200a	T	A	10: 25,993,927	H148L	probably damaging	Het
Trappc8	A	G	18: 20,834,940		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ubr4	T	A	4: 139,423,945	M1897K	probably damaging	Het
Uggt2	A	G	14: 119,061,376	L391P	probably damaging	Het
Uncx	T	C	5: 139,547,547	S456P	probably benign	Het
Vps13b	A	G	15: 35,879,791	Y3004C	probably damaging	Het
Wisp1	G	A	15: 66,906,489	C53Y	probably damaging	Het
Zbtb46	C	T	2: 181,391,431	C479Y	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp503	A	T	14: 21,985,520	C443S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in Llgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01137:Llgl1	APN	11	60709999	missense	probably benign	0.38
IGL01400:Llgl1	APN	11	60706490	missense	probably damaging	1.00
IGL03066:Llgl1	APN	11	60706034	missense	possibly damaging	0.75
IGL03174:Llgl1	APN	11	60706210	missense	probably benign	0.15
IGL03306:Llgl1	APN	11	60711354	missense	possibly damaging	0.92
R0284:Llgl1	UTSW	11	60712141	missense	probably damaging	0.98
R1137:Llgl1	UTSW	11	60704733	missense	probably benign	0.01
R1432:Llgl1	UTSW	11	60708554	missense	probably damaging	1.00
R1769:Llgl1	UTSW	11	60707047	missense	probably damaging	1.00
R1835:Llgl1	UTSW	11	60704730	missense	probably benign	0.00
R1943:Llgl1	UTSW	11	60706016	missense	probably benign
R2197:Llgl1	UTSW	11	60710039	missense	possibly damaging	0.62
R2510:Llgl1	UTSW	11	60710036	missense	probably damaging	1.00
R2568:Llgl1	UTSW	11	60708812	missense	probably damaging	1.00
R3690:Llgl1	UTSW	11	60707002	missense	probably damaging	1.00
R3853:Llgl1	UTSW	11	60707249	missense	probably damaging	1.00
R4079:Llgl1	UTSW	11	60710284	splice site	probably null
R4259:Llgl1	UTSW	11	60709568	missense	probably benign
R4348:Llgl1	UTSW	11	60709568	missense	probably benign
R4349:Llgl1	UTSW	11	60709568	missense	probably benign
R4352:Llgl1	UTSW	11	60709568	missense	probably benign
R4353:Llgl1	UTSW	11	60709568	missense	probably benign
R4396:Llgl1	UTSW	11	60706008	missense	probably benign
R4584:Llgl1	UTSW	11	60712082	missense	probably damaging	0.99
R4594:Llgl1	UTSW	11	60706321	missense	probably benign	0.15
R4628:Llgl1	UTSW	11	60709985	missense	probably damaging	1.00
R4651:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4653:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4731:Llgl1	UTSW	11	60706225	nonsense	probably null
R4869:Llgl1	UTSW	11	60707210	nonsense	probably null
R4898:Llgl1	UTSW	11	60709568	missense	probably benign
R4899:Llgl1	UTSW	11	60709568	missense	probably benign
R4939:Llgl1	UTSW	11	60709979	critical splice acceptor site	probably null
R4941:Llgl1	UTSW	11	60709568	missense	probably benign
R4942:Llgl1	UTSW	11	60709568	missense	probably benign
R4958:Llgl1	UTSW	11	60711435	missense	probably benign	0.02
R4995:Llgl1	UTSW	11	60709724	missense	probably benign	0.00
R4997:Llgl1	UTSW	11	60709568	missense	probably benign
R5177:Llgl1	UTSW	11	60712007	missense	possibly damaging	0.94
R5257:Llgl1	UTSW	11	60711563	splice site	probably null
R5258:Llgl1	UTSW	11	60711563	splice site	probably null
R5401:Llgl1	UTSW	11	60706471	missense	probably benign
R5406:Llgl1	UTSW	11	60713184	missense	probably damaging	0.99
R5432:Llgl1	UTSW	11	60707623	missense	probably benign
R5587:Llgl1	UTSW	11	60710342	missense	probably benign	0.00
R5732:Llgl1	UTSW	11	60709460	missense	probably benign	0.00
R5758:Llgl1	UTSW	11	60708567	missense	probably damaging	1.00
R5879:Llgl1	UTSW	11	60712980	missense	probably benign	0.00
R6268:Llgl1	UTSW	11	60712163	missense	probably benign	0.13
R6286:Llgl1	UTSW	11	60709532	missense	probably damaging	1.00
R6455:Llgl1	UTSW	11	60709660	missense	probably damaging	0.98
R6805:Llgl1	UTSW	11	60702865	missense	probably benign	0.25
R6929:Llgl1	UTSW	11	60710353	nonsense	probably null
R7274:Llgl1	UTSW	11	60705986	missense	possibly damaging	0.89
R7889:Llgl1	UTSW	11	60707312	missense	probably damaging	1.00
R7986:Llgl1	UTSW	11	60711395	missense	probably benign	0.16
R8141:Llgl1	UTSW	11	60710316	missense	probably benign	0.02
R8176:Llgl1	UTSW	11	60706561	missense	probably benign	0.27
R8223:Llgl1	UTSW	11	60702822	missense	possibly damaging	0.86
R8332:Llgl1	UTSW	11	60710384	missense	possibly damaging	0.90
R8350:Llgl1	UTSW	11	60712121	missense	probably damaging	1.00
R8500:Llgl1	UTSW	11	60704983	critical splice donor site	probably null
R8979:Llgl1	UTSW	11	60710303	missense	probably benign	0.25
R9155:Llgl1	UTSW	11	60707108	missense	probably benign	0.00
R9163:Llgl1	UTSW	11	60709576	missense	probably benign	0.02
R9225:Llgl1	UTSW	11	60710063	missense	probably damaging	1.00
R9234:Llgl1	UTSW	11	60710130	critical splice donor site	probably null
Z1186:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1187:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1188:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1189:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1190:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1191:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1192:Llgl1	UTSW	11	60713097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CGTGTCATTGACTTCTTCACGG -3'
(R):5'- AAAGTTAGGCTGAAGGTCTCTC -3'

Sequencing Primer
(F):5'- GACTTCTTCACGGTGCACAG -3'
(R):5'- TCTGGGCTAGACTACACCC -3'

Posted On

2014-06-23