Incidental Mutation 'R1786:Gemin4'
ID202838
Institutional Source Beutler Lab
Gene Symbol Gemin4
Ensembl Gene ENSMUSG00000049396
Gene Namegem nuclear organelle associated protein 4
Synonyms
MMRRC Submission 039817-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1786 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location76210571-76217664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 76211050 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 962 (P962A)
Ref Sequence ENSEMBL: ENSMUSP00000099558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094014] [ENSMUST00000102500] [ENSMUST00000129853] [ENSMUST00000169560] [ENSMUST00000169701]
Predicted Effect probably benign
Transcript: ENSMUST00000094014
SMART Domains Protein: ENSMUSP00000091553
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 249 7.47e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102500
AA Change: P962A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127340
Predicted Effect probably benign
Transcript: ENSMUST00000129853
SMART Domains Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
TLC 1 166 6.2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably benign
Transcript: ENSMUST00000169560
SMART Domains Protein: ENSMUSP00000131151
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 217 4.92e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Meta Mutation Damage Score 0.1552 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Gemin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Gemin4 APN 11 76213485 missense probably benign 0.16
IGL01654:Gemin4 APN 11 76213398 missense probably damaging 1.00
IGL01656:Gemin4 APN 11 76213810 missense probably damaging 1.00
IGL02890:Gemin4 APN 11 76211264 missense probably damaging 1.00
IGL02967:Gemin4 APN 11 76212241 missense probably damaging 1.00
R0359:Gemin4 UTSW 11 76212162 missense probably benign 0.02
R0413:Gemin4 UTSW 11 76211322 missense probably benign 0.00
R1538:Gemin4 UTSW 11 76211161 missense probably benign 0.00
R1632:Gemin4 UTSW 11 76210989 missense probably benign 0.26
R1762:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1783:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1784:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1785:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1835:Gemin4 UTSW 11 76213296 missense possibly damaging 0.62
R2007:Gemin4 UTSW 11 76212618 missense possibly damaging 0.78
R2117:Gemin4 UTSW 11 76211001 missense possibly damaging 0.59
R2131:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2133:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2140:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2141:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2142:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R3937:Gemin4 UTSW 11 76212888 missense probably damaging 1.00
R4112:Gemin4 UTSW 11 76212819 missense probably damaging 0.99
R4444:Gemin4 UTSW 11 76212091 missense probably benign 0.00
R5502:Gemin4 UTSW 11 76213401 nonsense probably null
R5702:Gemin4 UTSW 11 76210837 missense probably benign 0.01
R5744:Gemin4 UTSW 11 76212165 missense probably damaging 1.00
R6044:Gemin4 UTSW 11 76212934 missense probably benign
R6924:Gemin4 UTSW 11 76212336 missense probably damaging 1.00
R6931:Gemin4 UTSW 11 76210956 missense probably damaging 0.99
R7278:Gemin4 UTSW 11 76212106 missense probably damaging 0.98
R7286:Gemin4 UTSW 11 76212753 missense probably damaging 0.96
R7288:Gemin4 UTSW 11 76213380 missense possibly damaging 0.60
R7358:Gemin4 UTSW 11 76213452 nonsense probably null
R7572:Gemin4 UTSW 11 76213582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTACCTTCTGGAGCAAGG -3'
(R):5'- TTCCCCTGCTCAACCTGAAG -3'

Sequencing Primer
(F):5'- AGCTGACAGAAGGGTTGCTTTTG -3'
(R):5'- TGAAGCCTTTTGCCCAGGAAC -3'
Posted On2014-06-23