Incidental Mutation 'R1786:Qrich2'
ID 202842
Institutional Source Beutler Lab
Gene Symbol Qrich2
Ensembl Gene ENSMUSG00000070331
Gene Name glutamine rich 2
Synonyms LOC217341
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 116332151-116357067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 116332275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 2307 (G2307D)
Ref Sequence ENSEMBL: ENSMUSP00000147009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057676] [ENSMUST00000093909] [ENSMUST00000208602]
AlphaFold Q3V2A7
Predicted Effect probably benign
Transcript: ENSMUST00000057676
SMART Domains Protein: ENSMUSP00000058894
Gene: ENSMUSG00000050628

DomainStartEndE-ValueType
Pfam:UBA_4 11 53 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093909
AA Change: G562D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091437
Gene: ENSMUSG00000070331
AA Change: G562D

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DUF4795 97 304 3.7e-71 PFAM
low complexity region 471 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134182
SMART Domains Protein: ENSMUSP00000115947
Gene: ENSMUSG00000070331

DomainStartEndE-ValueType
Blast:MYSc 1 287 4e-80 BLAST
coiled coil region 336 351 N/A INTRINSIC
low complexity region 602 622 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144310
Predicted Effect probably damaging
Transcript: ENSMUST00000208602
AA Change: G2307D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Qrich2
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4449:Qrich2 UTSW 11 116,347,025 (GRCm39) small deletion probably benign
R0122:Qrich2 UTSW 11 116,337,639 (GRCm39) missense possibly damaging 0.61
R0157:Qrich2 UTSW 11 116,332,221 (GRCm39) missense probably damaging 1.00
R1479:Qrich2 UTSW 11 116,332,311 (GRCm39) missense probably benign 0.08
R2115:Qrich2 UTSW 11 116,337,982 (GRCm39) missense probably damaging 0.99
R2130:Qrich2 UTSW 11 116,339,243 (GRCm39) splice site probably benign
R2178:Qrich2 UTSW 11 116,334,603 (GRCm39) missense probably damaging 1.00
R3875:Qrich2 UTSW 11 116,336,477 (GRCm39) missense probably damaging 0.98
R4378:Qrich2 UTSW 11 116,337,741 (GRCm39) missense probably damaging 1.00
R5124:Qrich2 UTSW 11 116,337,599 (GRCm39) missense probably damaging 1.00
R5362:Qrich2 UTSW 11 116,337,976 (GRCm39) missense probably damaging 1.00
R5468:Qrich2 UTSW 11 116,339,191 (GRCm39) missense probably damaging 1.00
R5493:Qrich2 UTSW 11 116,336,774 (GRCm39) critical splice donor site probably null
R5589:Qrich2 UTSW 11 116,332,234 (GRCm39) missense probably damaging 1.00
R5696:Qrich2 UTSW 11 116,335,828 (GRCm39) missense probably damaging 1.00
R6046:Qrich2 UTSW 11 116,337,832 (GRCm39) intron probably benign
R6183:Qrich2 UTSW 11 116,348,955 (GRCm39) unclassified probably benign
R6193:Qrich2 UTSW 11 116,344,979 (GRCm39) missense probably benign 0.07
R6211:Qrich2 UTSW 11 116,344,368 (GRCm39) missense probably benign 0.41
R6375:Qrich2 UTSW 11 116,349,054 (GRCm39) unclassified probably benign
R6452:Qrich2 UTSW 11 116,346,714 (GRCm39) missense probably benign 0.01
R6870:Qrich2 UTSW 11 116,346,156 (GRCm39) missense probably damaging 0.96
R7073:Qrich2 UTSW 11 116,337,701 (GRCm39) missense probably damaging 0.98
R7552:Qrich2 UTSW 11 116,347,080 (GRCm39) missense possibly damaging 0.63
R7585:Qrich2 UTSW 11 116,346,547 (GRCm39) missense probably benign 0.00
R7586:Qrich2 UTSW 11 116,346,450 (GRCm39) missense probably benign 0.43
R7588:Qrich2 UTSW 11 116,356,763 (GRCm39) missense possibly damaging 0.53
R7633:Qrich2 UTSW 11 116,347,455 (GRCm39) missense unknown
R7638:Qrich2 UTSW 11 116,346,148 (GRCm39) missense probably benign 0.00
R7736:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R7737:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R7753:Qrich2 UTSW 11 116,347,868 (GRCm39) small deletion probably benign
R7800:Qrich2 UTSW 11 116,347,686 (GRCm39) nonsense probably null
R7833:Qrich2 UTSW 11 116,346,591 (GRCm39) missense probably benign 0.04
R7912:Qrich2 UTSW 11 116,346,608 (GRCm39) small deletion probably benign
R7923:Qrich2 UTSW 11 116,348,163 (GRCm39) missense probably damaging 1.00
R8197:Qrich2 UTSW 11 116,347,861 (GRCm39) small deletion probably benign
R8225:Qrich2 UTSW 11 116,344,894 (GRCm39) missense probably damaging 1.00
R8300:Qrich2 UTSW 11 116,347,175 (GRCm39) missense probably benign 0.04
R8391:Qrich2 UTSW 11 116,356,403 (GRCm39) missense probably benign 0.00
R8705:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R8792:Qrich2 UTSW 11 116,347,456 (GRCm39) missense unknown
R8912:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9025:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9121:Qrich2 UTSW 11 116,347,272 (GRCm39) missense unknown
R9130:Qrich2 UTSW 11 116,347,692 (GRCm39) nonsense probably null
R9219:Qrich2 UTSW 11 116,335,900 (GRCm39) missense possibly damaging 0.47
R9254:Qrich2 UTSW 11 116,348,934 (GRCm39) missense unknown
R9256:Qrich2 UTSW 11 116,356,450 (GRCm39) missense probably benign 0.10
R9288:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9379:Qrich2 UTSW 11 116,348,934 (GRCm39) missense unknown
R9448:Qrich2 UTSW 11 116,338,091 (GRCm39) missense probably benign 0.01
R9521:Qrich2 UTSW 11 116,339,208 (GRCm39) missense probably damaging 1.00
R9620:Qrich2 UTSW 11 116,337,946 (GRCm39) missense probably damaging 1.00
R9631:Qrich2 UTSW 11 116,348,367 (GRCm39) small deletion probably benign
R9639:Qrich2 UTSW 11 116,346,924 (GRCm39) missense probably benign 0.00
R9694:Qrich2 UTSW 11 116,337,946 (GRCm39) missense probably damaging 1.00
Z1176:Qrich2 UTSW 11 116,347,204 (GRCm39) missense probably benign 0.00
Z1177:Qrich2 UTSW 11 116,347,494 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTCTTGAGGCAGGGCATC -3'
(R):5'- AATGCTTGTAACTGTGTGGCC -3'

Sequencing Primer
(F):5'- TCAGAGAGATCCCTTGGCAC -3'
(R):5'- CTAATGGGGTTCACAACTTGC -3'
Posted On 2014-06-23