Mutagenetix > Incidental Mutation

Incidental Mutation 'R1786:Lifr'

202856

Institutional Source

Beutler Lab

Gene Symbol

Lifr

Ensembl Gene

ENSMUSG00000054263

Gene Name

leukemia inhibitory factor receptor

Synonyms

A230075M04Rik, soluble differentiation-stimulating factor receptor

MMRRC Submission

039817-MU

Accession Numbers

Genbank: NM_013584; MGI: 96788

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1786 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7090614-7197489 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 7181856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 625 (D625G)

Ref Sequence

ENSEMBL: ENSMUSP00000154181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]

AlphaFold

P42703

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067190
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: D625G

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
Blast:FN3	45	118	5e-22	BLAST
FN3	328	399	1.86e1	SMART
FN3	425	515	9.77e-5	SMART
FN3	530	611	2.68e0	SMART
FN3	620	705	8.23e1	SMART
FN3	719	815	4.81e-4	SMART
transmembrane domain	830	852	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164529
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: D625G

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
Blast:FN3	45	118	4e-22	BLAST
FN3	328	399	1.86e1	SMART
FN3	425	515	9.77e-5	SMART
FN3	530	611	2.68e0	SMART
FN3	620	705	8.23e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171588
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: D625G

Domain	Start	End	E-Value	Type
low complexity region	25	37	N/A	INTRINSIC
Blast:FN3	45	118	5e-22	BLAST
FN3	328	399	1.86e1	SMART
FN3	425	515	9.77e-5	SMART
FN3	530	611	2.68e0	SMART
FN3	620	705	8.23e1	SMART
FN3	719	815	4.81e-4	SMART
transmembrane domain	830	852	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226471
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226934
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227727
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.1018

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

97% (98/101)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,210,149	C656S	probably benign	Het
9030624J02Rik	T	C	7: 118,794,575	Y516H	probably damaging	Het
A2ml1	T	A	6: 128,576,260	N178I	probably damaging	Het
Abcc4	G	A	14: 118,553,349	R749C	probably damaging	Het
Acot11	T	C	4: 106,762,035	E201G	probably damaging	Het
Akap13	G	T	7: 75,611,434	A1269S	probably benign	Het
Aldh4a1	T	C	4: 139,644,128	V451A	probably benign	Het
Aox3	A	G	1: 58,169,843	H845R	probably damaging	Het
Asb6	G	A	2: 30,827,076	R46W	probably damaging	Het
Bpifb6	T	C	2: 153,906,861	F259S	probably damaging	Het
Cad	T	A	5: 31,058,072	F76I	probably damaging	Het
Camk2b	T	C	11: 5,977,880	E390G	probably benign	Het
Cars	C	A	7: 143,592,474	R71M	probably damaging	Het
Ccdc170	T	G	10: 4,519,043	I197S	probably benign	Het
Cdc20b	A	T	13: 113,081,134	K362N	probably damaging	Het
Cntrl	CAGAG	CAG	2: 35,122,806		probably null	Het
Cpd	T	C	11: 76,792,798	D1045G	probably benign	Het
Crocc	T	C	4: 141,021,802	D1564G	probably damaging	Het
Csf1r	A	T	18: 61,129,077	M802L	probably damaging	Het
Dctn4	T	C	18: 60,546,335		probably null	Het
Dnah5	A	G	15: 28,313,786	Q1916R	probably damaging	Het
Dpysl2	A	G	14: 66,862,665		probably benign	Het
Dync2h1	A	G	9: 7,081,084	Y2871H	probably damaging	Het
Fam221b	T	A	4: 43,665,537	H307L	probably damaging	Het
Foxn4	C	T	5: 114,263,132	D37N	probably damaging	Het
Gemin4	G	C	11: 76,211,050	P962A	probably damaging	Het
Gm9797	T	C	10: 11,609,325		noncoding transcript	Het
Golim4	A	T	3: 75,908,149	V116D	probably damaging	Het
Gper1	C	T	5: 139,426,722	P274L	probably damaging	Het
Gpr132	A	G	12: 112,852,403	S268P	probably damaging	Het
Gtpbp2	T	C	17: 46,161,202	M21T	probably benign	Het
Hivep1	C	T	13: 42,183,786	A2447V	possibly damaging	Het
Ift20	G	A	11: 78,540,034	E68K	probably damaging	Het
Insrr	G	A	3: 87,810,572		probably null	Het
Kcnh8	T	C	17: 52,893,933	V465A	probably damaging	Het
Kif5c	T	A	2: 49,758,805		probably benign	Het
Kmt2a	G	A	9: 44,819,675		probably benign	Het
Lhx6	G	T	2: 36,087,458	C327*	probably null	Het
Llgl1	T	C	11: 60,707,240	V370A	probably benign	Het
Lman1	A	T	18: 65,991,582	M362K	probably damaging	Het
Lmtk2	C	T	5: 144,174,988	T842I	possibly damaging	Het
Lpin3	T	A	2: 160,896,809	L227*	probably null	Het
Ltv1	C	G	10: 13,182,536		probably benign	Het
Magel2	A	T	7: 62,377,738	H130L	unknown	Het
Mettl17	A	T	14: 51,888,735		probably benign	Het
Mnx1	T	A	5: 29,474,189	S299C	unknown	Het
Mov10	A	T	3: 104,818,116	I59N	possibly damaging	Het
Myo7b	T	C	18: 31,994,897	I581V	probably benign	Het
Ncdn	T	A	4: 126,745,273		probably null	Het
Ndufa4	A	T	6: 11,900,575	V37E	probably benign	Het
Nhsl1	T	G	10: 18,524,664	L546R	probably benign	Het
Nop9	T	C	14: 55,751,142	L347P	probably damaging	Het
Nrp1	A	T	8: 128,498,516	E782D	probably damaging	Het
Ntrk3	G	A	7: 78,477,935		probably benign	Het
Olfr341	A	G	2: 36,480,047	S28P	possibly damaging	Het
Olfr372	A	G	8: 72,058,436	Y252C	probably damaging	Het
Olfr968	A	T	9: 39,772,495	C102S	probably benign	Het
Osbpl6	T	A	2: 76,586,214	I546K	probably damaging	Het
Pard6g	T	C	18: 80,117,308	V212A	probably damaging	Het
Pknox2	A	G	9: 36,909,684	V294A	probably damaging	Het
Plekha1	T	C	7: 130,892,253	V106A	probably benign	Het
Plekha6	C	A	1: 133,279,365		probably null	Het
Ptgdr	A	T	14: 44,858,579	Y225*	probably null	Het
Ptpn22	A	G	3: 103,874,052	I90V	probably damaging	Het
Pygb	C	T	2: 150,816,772	T372I	probably damaging	Het
Pzp	T	C	6: 128,491,161		probably null	Het
Qrich2	C	T	11: 116,441,449	G2307D	probably damaging	Het
Rfwd3	A	T	8: 111,297,402	V96E	probably benign	Het
Senp1	T	A	15: 98,075,967	T132S	probably benign	Het
Slc9a4	T	G	1: 40,607,741		probably null	Het
Slfn9	T	A	11: 82,981,307	I868F	probably damaging	Het
St3gal6	T	C	16: 58,475,871	D137G	probably damaging	Het
Synj1	G	T	16: 90,964,517	A687D	probably damaging	Het
Syt4	A	G	18: 31,443,443		probably benign	Het
Tacc1	A	T	8: 25,164,493	N271K	probably damaging	Het
Tdrd6	T	C	17: 43,624,833	T1775A	probably benign	Het
Tecpr1	T	A	5: 144,208,645	T595S	probably benign	Het
Tjp3	T	A	10: 81,278,054	M457L	possibly damaging	Het
Tmem200a	T	A	10: 25,993,927	H148L	probably damaging	Het
Trappc8	A	G	18: 20,834,940		probably null	Het
Txk	T	A	5: 72,696,579	T472S	probably damaging	Het
Ubr4	T	A	4: 139,423,945	M1897K	probably damaging	Het
Uggt2	A	G	14: 119,061,376	L391P	probably damaging	Het
Uncx	T	C	5: 139,547,547	S456P	probably benign	Het
Vps13b	A	G	15: 35,879,791	Y3004C	probably damaging	Het
Wisp1	G	A	15: 66,906,489	C53Y	probably damaging	Het
Zbtb46	C	T	2: 181,391,431	C479Y	probably damaging	Het
Zc3h7a	A	T	16: 11,150,605	Y503*	probably null	Het
Zdhhc13	T	A	7: 48,824,644	L548Q	possibly damaging	Het
Zfp236	T	C	18: 82,621,304	M1225V	probably benign	Het
Zfp280d	T	C	9: 72,308,005	F133L	probably damaging	Het
Zfp503	A	T	14: 21,985,520	C443S	possibly damaging	Het
Zfyve26	T	A	12: 79,268,434	I1423F	possibly damaging	Het

Other mutations in Lifr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00702:Lifr	APN	15	7185739	splice site	probably null
IGL01470:Lifr	APN	15	7175666	nonsense	probably null
IGL01489:Lifr	APN	15	7175556	splice site	probably benign
IGL01619:Lifr	APN	15	7191162	missense	probably damaging	1.00
IGL01636:Lifr	APN	15	7179018	splice site	probably benign
IGL01943:Lifr	APN	15	7188149	missense	probably damaging	1.00
IGL02253:Lifr	APN	15	7190604	missense	probably damaging	1.00
IGL02355:Lifr	APN	15	7164693	critical splice donor site	probably null
IGL02362:Lifr	APN	15	7164693	critical splice donor site	probably null
IGL02450:Lifr	APN	15	7190765	missense	probably damaging	1.00
IGL02477:Lifr	APN	15	7186923	missense	probably damaging	1.00
IGL02503:Lifr	APN	15	7185623	missense	probably damaging	1.00
IGL02571:Lifr	APN	15	7190111	unclassified	probably benign
IGL03340:Lifr	APN	15	7177936	missense	probably benign	0.02
N/A - 535:Lifr	UTSW	15	7186953	missense	possibly damaging	0.80
R0012:Lifr	UTSW	15	7175608	missense	possibly damaging	0.78
R0015:Lifr	UTSW	15	7188186	splice site	probably null
R0102:Lifr	UTSW	15	7178892	missense	probably damaging	0.98
R0102:Lifr	UTSW	15	7178892	missense	probably damaging	0.98
R0305:Lifr	UTSW	15	7177501	missense	probably damaging	0.99
R0416:Lifr	UTSW	15	7166914	missense	probably damaging	1.00
R0440:Lifr	UTSW	15	7157191	nonsense	probably null
R0519:Lifr	UTSW	15	7177580	missense	probably damaging	1.00
R0595:Lifr	UTSW	15	7177469	missense	probably damaging	1.00
R0601:Lifr	UTSW	15	7169272	splice site	probably null
R0780:Lifr	UTSW	15	7177466	missense	probably benign	0.00
R0790:Lifr	UTSW	15	7185715	missense	probably benign	0.13
R1376:Lifr	UTSW	15	7184764	missense	probably benign	0.04
R1376:Lifr	UTSW	15	7184764	missense	probably benign	0.04
R1400:Lifr	UTSW	15	7190865	missense	probably benign	0.04
R1498:Lifr	UTSW	15	7190618	missense	probably damaging	0.99
R1785:Lifr	UTSW	15	7181856	missense	possibly damaging	0.89
R1906:Lifr	UTSW	15	7188131	missense	probably damaging	0.98
R2099:Lifr	UTSW	15	7157251	missense	probably benign
R2102:Lifr	UTSW	15	7186923	missense	probably damaging	1.00
R2136:Lifr	UTSW	15	7181857	missense	possibly damaging	0.89
R2511:Lifr	UTSW	15	7166916	missense	probably benign
R4375:Lifr	UTSW	15	7166898	missense	probably benign
R4883:Lifr	UTSW	15	7185625	missense	possibly damaging	0.94
R5681:Lifr	UTSW	15	7191084	missense	probably damaging	1.00
R5689:Lifr	UTSW	15	7184804	missense	probably damaging	1.00
R5693:Lifr	UTSW	15	7175560	missense	probably damaging	1.00
R5902:Lifr	UTSW	15	7190750	missense	probably benign
R5918:Lifr	UTSW	15	7159416	missense	probably benign	0.00
R5924:Lifr	UTSW	15	7172972	missense	probably benign	0.28
R6037:Lifr	UTSW	15	7186943	missense	probably damaging	1.00
R6037:Lifr	UTSW	15	7186943	missense	probably damaging	1.00
R6289:Lifr	UTSW	15	7166910	missense	probably benign	0.00
R6339:Lifr	UTSW	15	7167049	missense	probably benign	0.01
R6860:Lifr	UTSW	15	7172937	missense	probably benign	0.02
R7106:Lifr	UTSW	15	7172924	missense	probably benign	0.02
R7107:Lifr	UTSW	15	7178940	missense	possibly damaging	0.88
R7274:Lifr	UTSW	15	7167059	critical splice donor site	probably null
R7625:Lifr	UTSW	15	7169242	missense	probably damaging	0.99
R7631:Lifr	UTSW	15	7184777	missense	probably damaging	1.00
R7958:Lifr	UTSW	15	7181997	missense	possibly damaging	0.62
R7991:Lifr	UTSW	15	7173482	missense	possibly damaging	0.79
R8175:Lifr	UTSW	15	7187015	missense	probably damaging	1.00
R8427:Lifr	UTSW	15	7190981	missense	probably benign	0.01
R9274:Lifr	UTSW	15	7188110	missense	probably damaging	0.98
R9311:Lifr	UTSW	15	7178937	missense	possibly damaging	0.47
R9365:Lifr	UTSW	15	7169040	missense	probably damaging	1.00
R9509:Lifr	UTSW	15	7159474	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCTCAGCTTCTGAATAAAGGTAGATG -3'
(R):5'- AGCCACGGATTCTTACCAGAC -3'

Sequencing Primer
(F):5'- GCTACCTAGTTTAACCACTGT -3'
(R):5'- CGGATTCTTACCAGACTCTATGACAG -3'

Posted On

2014-06-23