Incidental Mutation 'R1786:Lifr'
ID 202856
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Name LIF receptor alpha
Synonyms soluble differentiation-stimulating factor receptor, A230075M04Rik
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 7120095-7226970 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7211337 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 625 (D625G)
Ref Sequence ENSEMBL: ENSMUSP00000154181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
AlphaFold P42703
Predicted Effect possibly damaging
Transcript: ENSMUST00000067190
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: D625G

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164529
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263
AA Change: D625G

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171588
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: D625G

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226471
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226934
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227727
AA Change: D625G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7,215,220 (GRCm39) splice site probably null
IGL01470:Lifr APN 15 7,205,147 (GRCm39) nonsense probably null
IGL01489:Lifr APN 15 7,205,037 (GRCm39) splice site probably benign
IGL01619:Lifr APN 15 7,220,643 (GRCm39) missense probably damaging 1.00
IGL01636:Lifr APN 15 7,208,499 (GRCm39) splice site probably benign
IGL01943:Lifr APN 15 7,217,630 (GRCm39) missense probably damaging 1.00
IGL02253:Lifr APN 15 7,220,085 (GRCm39) missense probably damaging 1.00
IGL02355:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02362:Lifr APN 15 7,194,174 (GRCm39) critical splice donor site probably null
IGL02450:Lifr APN 15 7,220,246 (GRCm39) missense probably damaging 1.00
IGL02477:Lifr APN 15 7,216,404 (GRCm39) missense probably damaging 1.00
IGL02503:Lifr APN 15 7,215,104 (GRCm39) missense probably damaging 1.00
IGL02571:Lifr APN 15 7,219,592 (GRCm39) unclassified probably benign
IGL03340:Lifr APN 15 7,207,417 (GRCm39) missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7,216,434 (GRCm39) missense possibly damaging 0.80
R0012:Lifr UTSW 15 7,205,089 (GRCm39) missense possibly damaging 0.78
R0015:Lifr UTSW 15 7,217,667 (GRCm39) splice site probably null
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0102:Lifr UTSW 15 7,208,373 (GRCm39) missense probably damaging 0.98
R0305:Lifr UTSW 15 7,206,982 (GRCm39) missense probably damaging 0.99
R0416:Lifr UTSW 15 7,196,395 (GRCm39) missense probably damaging 1.00
R0440:Lifr UTSW 15 7,186,672 (GRCm39) nonsense probably null
R0519:Lifr UTSW 15 7,207,061 (GRCm39) missense probably damaging 1.00
R0595:Lifr UTSW 15 7,206,950 (GRCm39) missense probably damaging 1.00
R0601:Lifr UTSW 15 7,198,753 (GRCm39) splice site probably null
R0780:Lifr UTSW 15 7,206,947 (GRCm39) missense probably benign 0.00
R0790:Lifr UTSW 15 7,215,196 (GRCm39) missense probably benign 0.13
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1376:Lifr UTSW 15 7,214,245 (GRCm39) missense probably benign 0.04
R1400:Lifr UTSW 15 7,220,346 (GRCm39) missense probably benign 0.04
R1498:Lifr UTSW 15 7,220,099 (GRCm39) missense probably damaging 0.99
R1785:Lifr UTSW 15 7,211,337 (GRCm39) missense possibly damaging 0.89
R1906:Lifr UTSW 15 7,217,612 (GRCm39) missense probably damaging 0.98
R2099:Lifr UTSW 15 7,186,732 (GRCm39) missense probably benign
R2102:Lifr UTSW 15 7,216,404 (GRCm39) missense probably damaging 1.00
R2136:Lifr UTSW 15 7,211,338 (GRCm39) missense possibly damaging 0.89
R2511:Lifr UTSW 15 7,196,397 (GRCm39) missense probably benign
R4375:Lifr UTSW 15 7,196,379 (GRCm39) missense probably benign
R4883:Lifr UTSW 15 7,215,106 (GRCm39) missense possibly damaging 0.94
R5681:Lifr UTSW 15 7,220,565 (GRCm39) missense probably damaging 1.00
R5689:Lifr UTSW 15 7,214,285 (GRCm39) missense probably damaging 1.00
R5693:Lifr UTSW 15 7,205,041 (GRCm39) missense probably damaging 1.00
R5902:Lifr UTSW 15 7,220,231 (GRCm39) missense probably benign
R5918:Lifr UTSW 15 7,188,897 (GRCm39) missense probably benign 0.00
R5924:Lifr UTSW 15 7,202,453 (GRCm39) missense probably benign 0.28
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6037:Lifr UTSW 15 7,216,424 (GRCm39) missense probably damaging 1.00
R6289:Lifr UTSW 15 7,196,391 (GRCm39) missense probably benign 0.00
R6339:Lifr UTSW 15 7,196,530 (GRCm39) missense probably benign 0.01
R6860:Lifr UTSW 15 7,202,418 (GRCm39) missense probably benign 0.02
R7106:Lifr UTSW 15 7,202,405 (GRCm39) missense probably benign 0.02
R7107:Lifr UTSW 15 7,208,421 (GRCm39) missense possibly damaging 0.88
R7274:Lifr UTSW 15 7,196,540 (GRCm39) critical splice donor site probably null
R7625:Lifr UTSW 15 7,198,723 (GRCm39) missense probably damaging 0.99
R7631:Lifr UTSW 15 7,214,258 (GRCm39) missense probably damaging 1.00
R7958:Lifr UTSW 15 7,211,478 (GRCm39) missense possibly damaging 0.62
R7991:Lifr UTSW 15 7,202,963 (GRCm39) missense possibly damaging 0.79
R8175:Lifr UTSW 15 7,216,496 (GRCm39) missense probably damaging 1.00
R8427:Lifr UTSW 15 7,220,462 (GRCm39) missense probably benign 0.01
R9274:Lifr UTSW 15 7,217,591 (GRCm39) missense probably damaging 0.98
R9311:Lifr UTSW 15 7,208,418 (GRCm39) missense possibly damaging 0.47
R9365:Lifr UTSW 15 7,198,521 (GRCm39) missense probably damaging 1.00
R9509:Lifr UTSW 15 7,188,955 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCAGCTTCTGAATAAAGGTAGATG -3'
(R):5'- AGCCACGGATTCTTACCAGAC -3'

Sequencing Primer
(F):5'- GCTACCTAGTTTAACCACTGT -3'
(R):5'- CGGATTCTTACCAGACTCTATGACAG -3'
Posted On 2014-06-23