Incidental Mutation 'R1786:Zc3h7a'
ID 202863
Institutional Source Beutler Lab
Gene Symbol Zc3h7a
Ensembl Gene ENSMUSG00000037965
Gene Name zinc finger CCCH type containing 7 A
Synonyms A430104C18Rik, Zc3h7
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 10954458-10994257 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 10968469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 503 (Y503*)
Ref Sequence ENSEMBL: ENSMUSP00000119480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037633] [ENSMUST00000128083] [ENSMUST00000138185] [ENSMUST00000140755]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000037633
AA Change: Y503*
SMART Domains Protein: ENSMUSP00000041308
Gene: ENSMUSG00000037965
AA Change: Y503*

DomainStartEndE-ValueType
PDB:2DBA|A 26 157 9e-7 PDB
Blast:TPR 43 76 1e-7 BLAST
SCOP:d1ihga1 46 169 1e-11 SMART
Blast:TPR 124 156 9e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
ZnF_C2H2 443 467 1.83e2 SMART
ZnF_C3H1 630 654 1.57e1 SMART
ZnF_C3H1 770 795 8.81e0 SMART
ZnF_C2H2 856 880 1.62e0 SMART
ZnF_C3H1 902 926 1.76e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128083
AA Change: Y503*
SMART Domains Protein: ENSMUSP00000114246
Gene: ENSMUSG00000037965
AA Change: Y503*

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 2.7e-8 PFAM
Blast:TPR 124 156 4e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 2e-10 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000138185
AA Change: Y503*
SMART Domains Protein: ENSMUSP00000119480
Gene: ENSMUSG00000037965
AA Change: Y503*

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 3.9e-8 PFAM
Blast:TPR 124 156 6e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 380 398 N/A INTRINSIC
Blast:ZnF_C2H2 443 467 4e-10 BLAST
Blast:ZnF_C3H1 628 654 5e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139391
Predicted Effect probably benign
Transcript: ENSMUST00000140755
SMART Domains Protein: ENSMUSP00000120720
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Pfam:TPR_11 41 120 1e-7 PFAM
Blast:TPR 124 156 5e-9 BLAST
low complexity region 308 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140775
Predicted Effect probably benign
Transcript: ENSMUST00000140898
SMART Domains Protein: ENSMUSP00000118771
Gene: ENSMUSG00000037965

DomainStartEndE-ValueType
Blast:ZnF_C3H1 45 71 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145457
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Zc3h7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Zc3h7a APN 16 10,955,202 (GRCm39) missense probably damaging 0.98
IGL00908:Zc3h7a APN 16 10,963,106 (GRCm39) missense probably damaging 0.99
IGL01087:Zc3h7a APN 16 10,971,046 (GRCm39) missense probably benign 0.28
IGL01285:Zc3h7a APN 16 10,956,979 (GRCm39) missense probably damaging 1.00
IGL01453:Zc3h7a APN 16 10,967,242 (GRCm39) missense probably benign 0.00
IGL01639:Zc3h7a APN 16 10,959,572 (GRCm39) missense possibly damaging 0.75
IGL01716:Zc3h7a APN 16 10,963,580 (GRCm39) missense probably damaging 1.00
IGL02059:Zc3h7a APN 16 10,978,862 (GRCm39) unclassified probably benign
IGL02170:Zc3h7a APN 16 10,964,259 (GRCm39) missense probably benign
IGL02256:Zc3h7a APN 16 10,965,140 (GRCm39) missense probably benign 0.04
IGL02904:Zc3h7a APN 16 10,968,530 (GRCm39) missense probably damaging 1.00
IGL02941:Zc3h7a APN 16 10,976,458 (GRCm39) critical splice acceptor site probably null
IGL03198:Zc3h7a APN 16 10,980,528 (GRCm39) nonsense probably null
IGL03201:Zc3h7a APN 16 10,974,166 (GRCm39) critical splice acceptor site probably null
IGL03302:Zc3h7a APN 16 10,959,574 (GRCm39) missense probably damaging 1.00
agreement UTSW 16 10,971,025 (GRCm39) missense probably benign 0.02
Clement UTSW 16 10,982,466 (GRCm39) nonsense probably null
consensus UTSW 16 10,978,890 (GRCm39) missense probably damaging 1.00
R0062:Zc3h7a UTSW 16 10,957,011 (GRCm39) missense probably damaging 1.00
R0255:Zc3h7a UTSW 16 10,958,601 (GRCm39) missense probably damaging 1.00
R0376:Zc3h7a UTSW 16 10,974,066 (GRCm39) missense probably benign 0.00
R0545:Zc3h7a UTSW 16 10,970,197 (GRCm39) unclassified probably benign
R0666:Zc3h7a UTSW 16 10,974,167 (GRCm39) unclassified probably benign
R0831:Zc3h7a UTSW 16 10,969,744 (GRCm39) missense probably damaging 0.99
R1127:Zc3h7a UTSW 16 10,956,939 (GRCm39) missense probably damaging 1.00
R1296:Zc3h7a UTSW 16 10,978,890 (GRCm39) missense probably damaging 1.00
R1472:Zc3h7a UTSW 16 10,978,890 (GRCm39) missense probably damaging 1.00
R1499:Zc3h7a UTSW 16 10,980,520 (GRCm39) missense probably damaging 1.00
R1747:Zc3h7a UTSW 16 10,963,117 (GRCm39) missense possibly damaging 0.67
R1840:Zc3h7a UTSW 16 10,978,890 (GRCm39) missense probably damaging 1.00
R1866:Zc3h7a UTSW 16 10,965,168 (GRCm39) missense possibly damaging 0.81
R2055:Zc3h7a UTSW 16 10,955,340 (GRCm39) missense probably benign 0.00
R2131:Zc3h7a UTSW 16 10,968,469 (GRCm39) nonsense probably null
R2281:Zc3h7a UTSW 16 10,976,458 (GRCm39) unclassified probably benign
R2399:Zc3h7a UTSW 16 10,965,265 (GRCm39) missense probably damaging 1.00
R2979:Zc3h7a UTSW 16 10,976,837 (GRCm39) missense probably damaging 1.00
R3915:Zc3h7a UTSW 16 10,974,074 (GRCm39) missense possibly damaging 0.92
R4078:Zc3h7a UTSW 16 10,969,011 (GRCm39) missense probably benign 0.05
R4095:Zc3h7a UTSW 16 10,963,099 (GRCm39) missense probably damaging 1.00
R4208:Zc3h7a UTSW 16 10,982,508 (GRCm39) missense possibly damaging 0.60
R4444:Zc3h7a UTSW 16 10,968,457 (GRCm39) critical splice donor site probably null
R4739:Zc3h7a UTSW 16 10,959,573 (GRCm39) missense probably damaging 1.00
R5059:Zc3h7a UTSW 16 10,978,985 (GRCm39) frame shift probably null
R5545:Zc3h7a UTSW 16 10,966,315 (GRCm39) missense possibly damaging 0.89
R5815:Zc3h7a UTSW 16 10,974,050 (GRCm39) missense probably damaging 0.98
R5915:Zc3h7a UTSW 16 10,982,466 (GRCm39) nonsense probably null
R5993:Zc3h7a UTSW 16 10,968,526 (GRCm39) missense probably damaging 1.00
R6183:Zc3h7a UTSW 16 10,965,234 (GRCm39) missense possibly damaging 0.81
R6459:Zc3h7a UTSW 16 10,971,025 (GRCm39) missense probably damaging 1.00
R6513:Zc3h7a UTSW 16 10,976,629 (GRCm39) critical splice acceptor site probably null
R6700:Zc3h7a UTSW 16 10,976,831 (GRCm39) missense possibly damaging 0.59
R6904:Zc3h7a UTSW 16 10,963,535 (GRCm39) missense probably damaging 1.00
R6964:Zc3h7a UTSW 16 10,967,088 (GRCm39) missense probably benign 0.00
R7354:Zc3h7a UTSW 16 10,966,378 (GRCm39) missense probably damaging 1.00
R7667:Zc3h7a UTSW 16 10,956,890 (GRCm39) nonsense probably null
R7742:Zc3h7a UTSW 16 10,971,025 (GRCm39) missense probably benign 0.02
R7780:Zc3h7a UTSW 16 10,967,115 (GRCm39) missense probably benign 0.26
R8228:Zc3h7a UTSW 16 10,956,954 (GRCm39) missense probably damaging 1.00
R8302:Zc3h7a UTSW 16 10,955,249 (GRCm39) missense probably damaging 1.00
R8309:Zc3h7a UTSW 16 10,964,417 (GRCm39) intron probably benign
R8795:Zc3h7a UTSW 16 10,965,147 (GRCm39) missense possibly damaging 0.65
R9060:Zc3h7a UTSW 16 10,969,047 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACACAATGCCGTGCTCC -3'
(R):5'- ACGGCTGCTACAATTGAAAGC -3'

Sequencing Primer
(F):5'- AGTCAGAAGTCTTCGCCACTGAG -3'
(R):5'- GGCTGCTACAATTGAAAGCTACTTG -3'
Posted On 2014-06-23