Incidental Mutation 'R1786:Synj1'
ID 202866
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Name synaptojanin 1
Synonyms A930006D20Rik
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1786 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90732980-90808196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 90761405 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 687 (A687D)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000130813] [ENSMUST00000170853] [ENSMUST00000231472]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118246
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: A661D
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: A661D

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121759
AA Change: A687D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: A687D

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130813
AA Change: A642D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119712
Gene: ENSMUSG00000022973
AA Change: A642D

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.4e-86 PFAM
low complexity region 441 459 N/A INTRINSIC
IPPc 526 693 1.8e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170853
AA Change: A647D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: A647D

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231472
Meta Mutation Damage Score 0.2254 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90,748,864 (GRCm39) missense probably damaging 1.00
IGL01468:Synj1 APN 16 90,807,060 (GRCm39) splice site probably benign
IGL02209:Synj1 APN 16 90,784,307 (GRCm39) missense probably damaging 0.97
IGL02452:Synj1 APN 16 90,758,253 (GRCm39) splice site probably benign
IGL02619:Synj1 APN 16 90,770,933 (GRCm39) missense probably damaging 1.00
IGL02650:Synj1 APN 16 90,773,584 (GRCm39) missense probably benign 0.03
IGL02708:Synj1 APN 16 90,788,350 (GRCm39) missense probably damaging 1.00
IGL02863:Synj1 APN 16 90,758,322 (GRCm39) missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90,785,056 (GRCm39) missense probably damaging 0.99
IGL03295:Synj1 APN 16 90,735,318 (GRCm39) missense probably benign 0.14
IGL03356:Synj1 APN 16 90,784,280 (GRCm39) missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90,761,396 (GRCm39) missense probably damaging 1.00
R0179:Synj1 UTSW 16 90,761,519 (GRCm39) missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90,735,528 (GRCm39) missense probably benign
R0426:Synj1 UTSW 16 90,764,242 (GRCm39) missense probably damaging 1.00
R0486:Synj1 UTSW 16 90,735,151 (GRCm39) utr 3 prime probably benign
R0515:Synj1 UTSW 16 90,790,910 (GRCm39) missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90,744,975 (GRCm39) missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0698:Synj1 UTSW 16 90,757,503 (GRCm39) missense probably benign 0.44
R0945:Synj1 UTSW 16 90,757,333 (GRCm39) missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90,743,743 (GRCm39) missense probably benign 0.05
R1562:Synj1 UTSW 16 90,784,290 (GRCm39) missense probably benign 0.09
R1732:Synj1 UTSW 16 90,761,118 (GRCm39) missense probably damaging 0.99
R1752:Synj1 UTSW 16 90,735,361 (GRCm39) missense probably benign
R1785:Synj1 UTSW 16 90,761,405 (GRCm39) missense probably damaging 1.00
R2011:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2012:Synj1 UTSW 16 90,735,584 (GRCm39) missense probably damaging 1.00
R2065:Synj1 UTSW 16 90,788,537 (GRCm39) critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90,766,217 (GRCm39) missense probably damaging 1.00
R3026:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R3151:Synj1 UTSW 16 90,757,514 (GRCm39) missense probably damaging 0.96
R3946:Synj1 UTSW 16 90,806,984 (GRCm39) missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90,788,491 (GRCm39) missense probably damaging 1.00
R4472:Synj1 UTSW 16 90,766,069 (GRCm39) critical splice donor site probably null
R4547:Synj1 UTSW 16 90,785,170 (GRCm39) missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90,770,877 (GRCm39) missense probably damaging 1.00
R4739:Synj1 UTSW 16 90,752,307 (GRCm39) missense probably benign 0.00
R5027:Synj1 UTSW 16 90,737,407 (GRCm39) splice site probably null
R5428:Synj1 UTSW 16 90,788,406 (GRCm39) missense probably damaging 0.98
R5586:Synj1 UTSW 16 90,806,865 (GRCm39) intron probably benign
R5769:Synj1 UTSW 16 90,735,141 (GRCm39) utr 3 prime probably benign
R6005:Synj1 UTSW 16 90,766,174 (GRCm39) missense probably damaging 1.00
R6119:Synj1 UTSW 16 90,735,877 (GRCm39) missense probably benign 0.30
R6313:Synj1 UTSW 16 90,743,703 (GRCm39) missense probably benign 0.00
R6324:Synj1 UTSW 16 90,735,518 (GRCm39) missense probably benign 0.00
R6549:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R6696:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6698:Synj1 UTSW 16 90,757,340 (GRCm39) missense probably damaging 0.98
R6861:Synj1 UTSW 16 90,760,768 (GRCm39) nonsense probably null
R7008:Synj1 UTSW 16 90,790,833 (GRCm39) missense probably damaging 1.00
R7153:Synj1 UTSW 16 90,744,978 (GRCm39) missense probably benign 0.04
R7393:Synj1 UTSW 16 90,748,887 (GRCm39) missense probably damaging 0.99
R7510:Synj1 UTSW 16 90,735,565 (GRCm39) missense probably benign
R7560:Synj1 UTSW 16 90,737,371 (GRCm39) missense probably benign
R7724:Synj1 UTSW 16 90,758,387 (GRCm39) missense probably damaging 0.99
R7913:Synj1 UTSW 16 90,788,315 (GRCm39) missense possibly damaging 0.83
R8326:Synj1 UTSW 16 90,785,084 (GRCm39) missense probably benign 0.12
R8707:Synj1 UTSW 16 90,752,319 (GRCm39) missense probably benign 0.02
R8711:Synj1 UTSW 16 90,806,971 (GRCm39) missense probably damaging 0.98
R8767:Synj1 UTSW 16 90,758,406 (GRCm39) missense probably damaging 1.00
R8911:Synj1 UTSW 16 90,775,622 (GRCm39) missense probably damaging 1.00
R9052:Synj1 UTSW 16 90,735,728 (GRCm39) missense probably benign 0.00
R9124:Synj1 UTSW 16 90,735,513 (GRCm39) missense probably benign 0.00
R9307:Synj1 UTSW 16 90,785,095 (GRCm39) missense probably damaging 0.98
R9408:Synj1 UTSW 16 90,741,740 (GRCm39) missense probably benign 0.27
R9458:Synj1 UTSW 16 90,766,200 (GRCm39) missense probably benign 0.05
R9567:Synj1 UTSW 16 90,790,912 (GRCm39) missense possibly damaging 0.79
R9651:Synj1 UTSW 16 90,757,343 (GRCm39) missense possibly damaging 0.56
R9651:Synj1 UTSW 16 90,735,412 (GRCm39) missense probably benign 0.00
R9707:Synj1 UTSW 16 90,758,300 (GRCm39) missense possibly damaging 0.91
R9730:Synj1 UTSW 16 90,757,552 (GRCm39) missense probably damaging 0.98
R9732:Synj1 UTSW 16 90,761,414 (GRCm39) missense probably damaging 1.00
Z1176:Synj1 UTSW 16 90,784,228 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCATCCGAATTGCAACG -3'
(R):5'- GCAGCTTGCATGAAAATGTTC -3'

Sequencing Primer
(F):5'- AATTGCAACGGCGCCCTTG -3'
(R):5'- TAAAGGGCGTGTAAAGCTTTCC -3'
Posted On 2014-06-23