Incidental Mutation 'R1786:Gtpbp2'
ID 202868
Institutional Source Beutler Lab
Gene Symbol Gtpbp2
Ensembl Gene ENSMUSG00000023952
Gene Name GTP binding protein 2
Synonyms nmf205
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.267) question?
Stock # R1786 (G1)
Quality Score 182
Status Validated
Chromosome 17
Chromosomal Location 46471958-46480296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46472128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 21 (M21T)
Ref Sequence ENSEMBL: ENSMUSP00000127896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000166563] [ENSMUST00000169383] [ENSMUST00000172170]
AlphaFold Q3UJK4
Predicted Effect probably benign
Transcript: ENSMUST00000024748
AA Change: M21T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952
AA Change: M21T

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165686
Predicted Effect probably benign
Transcript: ENSMUST00000166563
AA Change: M21T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000127896
Gene: ENSMUSG00000023952
AA Change: M21T

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167404
Predicted Effect unknown
Transcript: ENSMUST00000169383
AA Change: M21T
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952
AA Change: M21T

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169918
Predicted Effect probably benign
Transcript: ENSMUST00000172170
AA Change: M21T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952
AA Change: M21T

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171901
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pard6g T C 18: 80,160,523 (GRCm39) V212A probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Gtpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Gtpbp2 APN 17 46,479,180 (GRCm39) missense probably damaging 1.00
IGL01534:Gtpbp2 APN 17 46,474,430 (GRCm39) missense probably damaging 1.00
IGL02272:Gtpbp2 APN 17 46,475,707 (GRCm39) missense probably benign 0.00
IGL02864:Gtpbp2 APN 17 46,476,520 (GRCm39) missense probably benign 0.00
R0894:Gtpbp2 UTSW 17 46,476,895 (GRCm39) missense possibly damaging 0.85
R1575:Gtpbp2 UTSW 17 46,476,869 (GRCm39) missense probably damaging 1.00
R1632:Gtpbp2 UTSW 17 46,479,518 (GRCm39) missense probably benign
R1639:Gtpbp2 UTSW 17 46,476,697 (GRCm39) splice site probably null
R2132:Gtpbp2 UTSW 17 46,472,128 (GRCm39) missense probably benign 0.01
R2133:Gtpbp2 UTSW 17 46,472,128 (GRCm39) missense probably benign 0.01
R2223:Gtpbp2 UTSW 17 46,478,153 (GRCm39) missense probably benign
R3742:Gtpbp2 UTSW 17 46,476,808 (GRCm39) missense probably benign 0.03
R4060:Gtpbp2 UTSW 17 46,478,253 (GRCm39) missense probably damaging 1.00
R4061:Gtpbp2 UTSW 17 46,478,253 (GRCm39) missense probably damaging 1.00
R4064:Gtpbp2 UTSW 17 46,478,253 (GRCm39) missense probably damaging 1.00
R4387:Gtpbp2 UTSW 17 46,477,284 (GRCm39) missense probably benign 0.03
R4469:Gtpbp2 UTSW 17 46,472,239 (GRCm39) missense probably damaging 0.99
R4583:Gtpbp2 UTSW 17 46,472,071 (GRCm39) missense probably damaging 0.99
R4664:Gtpbp2 UTSW 17 46,472,080 (GRCm39) missense probably benign 0.33
R4724:Gtpbp2 UTSW 17 46,478,147 (GRCm39) critical splice acceptor site probably null
R5338:Gtpbp2 UTSW 17 46,478,760 (GRCm39) missense probably damaging 1.00
R5368:Gtpbp2 UTSW 17 46,477,230 (GRCm39) splice site probably benign
R5832:Gtpbp2 UTSW 17 46,478,788 (GRCm39) missense probably damaging 0.98
R6490:Gtpbp2 UTSW 17 46,479,147 (GRCm39) missense probably benign 0.01
R6526:Gtpbp2 UTSW 17 46,475,037 (GRCm39) splice site probably null
R6723:Gtpbp2 UTSW 17 46,479,202 (GRCm39) missense probably benign 0.05
R6860:Gtpbp2 UTSW 17 46,478,914 (GRCm39) intron probably benign
R7336:Gtpbp2 UTSW 17 46,472,239 (GRCm39) missense probably damaging 0.99
R7662:Gtpbp2 UTSW 17 46,477,361 (GRCm39) missense probably benign 0.00
R7710:Gtpbp2 UTSW 17 46,478,713 (GRCm39) missense possibly damaging 0.92
R8021:Gtpbp2 UTSW 17 46,475,195 (GRCm39) missense possibly damaging 0.91
R8334:Gtpbp2 UTSW 17 46,477,368 (GRCm39) missense possibly damaging 0.89
R9013:Gtpbp2 UTSW 17 46,475,740 (GRCm39) missense probably benign 0.05
R9445:Gtpbp2 UTSW 17 46,478,757 (GRCm39) missense probably damaging 0.99
R9715:Gtpbp2 UTSW 17 46,478,301 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGTATCCCTTGATGCCCTG -3'
(R):5'- CGGAAGAGTAGTTCCCCATG -3'

Sequencing Primer
(F):5'- TTTCTGACGCGACTAGGAGGAC -3'
(R):5'- AAGAGTAGTTCCCCATGGCTCC -3'
Posted On 2014-06-23