Incidental Mutation 'R1786:Kcnh8'
ID202869
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 039817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1786 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52893933 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 465 (V465A)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: V465A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: V465A

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.4934 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGTGTGTCAAAGGGGCTAC -3'
(R):5'- TCCCATTGTTGACTGACCAAG -3'

Sequencing Primer
(F):5'- GTGTCAAAGGGGCTACTTCATAC -3'
(R):5'- GTTGTCTGAAAGTACTCGAGCATCC -3'
Posted On2014-06-23