Incidental Mutation 'R1786:Pard6g'
ID 202876
Institutional Source Beutler Lab
Gene Symbol Pard6g
Ensembl Gene ENSMUSG00000056214
Gene Name par-6 family cell polarity regulator gamma
Synonyms 2410049N21Rik
MMRRC Submission 039817-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.377) question?
Stock # R1786 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 80090105-80162854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80160523 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 212 (V212A)
Ref Sequence ENSEMBL: ENSMUSP00000069182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070219]
AlphaFold Q9JK84
Predicted Effect probably damaging
Transcript: ENSMUST00000070219
AA Change: V212A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069182
Gene: ENSMUSG00000056214
AA Change: V212A

DomainStartEndE-ValueType
PB1 18 98 1.16e-16 SMART
PDZ 168 251 8.6e-14 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,553,223 (GRCm39) N178I probably damaging Het
Abcc4 G A 14: 118,790,761 (GRCm39) R749C probably damaging Het
Acot11 T C 4: 106,619,232 (GRCm39) E201G probably damaging Het
Akap13 G T 7: 75,261,182 (GRCm39) A1269S probably benign Het
Aldh4a1 T C 4: 139,371,439 (GRCm39) V451A probably benign Het
Aopep T A 13: 63,357,963 (GRCm39) C656S probably benign Het
Aox3 A G 1: 58,209,002 (GRCm39) H845R probably damaging Het
Asb6 G A 2: 30,717,088 (GRCm39) R46W probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cad T A 5: 31,215,416 (GRCm39) F76I probably damaging Het
Camk2b T C 11: 5,927,880 (GRCm39) E390G probably benign Het
Cars1 C A 7: 143,146,211 (GRCm39) R71M probably damaging Het
Ccdc170 T G 10: 4,469,043 (GRCm39) I197S probably benign Het
Ccn4 G A 15: 66,778,338 (GRCm39) C53Y probably damaging Het
Cdc20b A T 13: 113,217,668 (GRCm39) K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,012,818 (GRCm39) probably null Het
Cpd T C 11: 76,683,624 (GRCm39) D1045G probably benign Het
Crocc T C 4: 140,749,113 (GRCm39) D1564G probably damaging Het
Csf1r A T 18: 61,262,149 (GRCm39) M802L probably damaging Het
Dctn4 T C 18: 60,679,407 (GRCm39) probably null Het
Dnah5 A G 15: 28,313,932 (GRCm39) Q1916R probably damaging Het
Dpysl2 A G 14: 67,100,114 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,081,084 (GRCm39) Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 (GRCm39) H307L probably damaging Het
Foxn4 C T 5: 114,401,193 (GRCm39) D37N probably damaging Het
Gemin4 G C 11: 76,101,876 (GRCm39) P962A probably damaging Het
Gm9797 T C 10: 11,485,069 (GRCm39) noncoding transcript Het
Golim4 A T 3: 75,815,456 (GRCm39) V116D probably damaging Het
Gper1 C T 5: 139,412,477 (GRCm39) P274L probably damaging Het
Gpr132 A G 12: 112,816,023 (GRCm39) S268P probably damaging Het
Gtpbp2 T C 17: 46,472,128 (GRCm39) M21T probably benign Het
Hivep1 C T 13: 42,337,262 (GRCm39) A2447V possibly damaging Het
Ift20 G A 11: 78,430,860 (GRCm39) E68K probably damaging Het
Insrr G A 3: 87,717,879 (GRCm39) probably null Het
Kcnh8 T C 17: 53,200,961 (GRCm39) V465A probably damaging Het
Kif5c T A 2: 49,648,817 (GRCm39) probably benign Het
Kmt2a G A 9: 44,730,972 (GRCm39) probably benign Het
Lhx6 G T 2: 35,977,470 (GRCm39) C327* probably null Het
Lifr A G 15: 7,211,337 (GRCm39) D625G possibly damaging Het
Llgl1 T C 11: 60,598,066 (GRCm39) V370A probably benign Het
Lman1 A T 18: 66,124,653 (GRCm39) M362K probably damaging Het
Lmtk2 C T 5: 144,111,806 (GRCm39) T842I possibly damaging Het
Lpin3 T A 2: 160,738,729 (GRCm39) L227* probably null Het
Ltv1 C G 10: 13,058,280 (GRCm39) probably benign Het
Magel2 A T 7: 62,027,486 (GRCm39) H130L unknown Het
Mettl17 A T 14: 52,126,192 (GRCm39) probably benign Het
Mnx1 T A 5: 29,679,187 (GRCm39) S299C unknown Het
Mov10 A T 3: 104,725,432 (GRCm39) I59N possibly damaging Het
Myo7b T C 18: 32,127,950 (GRCm39) I581V probably benign Het
Ncdn T A 4: 126,639,066 (GRCm39) probably null Het
Ndufa4 A T 6: 11,900,574 (GRCm39) V37E probably benign Het
Nhsl1 T G 10: 18,400,412 (GRCm39) L546R probably benign Het
Nop9 T C 14: 55,988,599 (GRCm39) L347P probably damaging Het
Nrp1 A T 8: 129,224,997 (GRCm39) E782D probably damaging Het
Ntrk3 G A 7: 78,127,683 (GRCm39) probably benign Het
Or1j13 A G 2: 36,370,059 (GRCm39) S28P possibly damaging Het
Or2z8 A G 8: 72,812,280 (GRCm39) Y252C probably damaging Het
Or8g53 A T 9: 39,683,791 (GRCm39) C102S probably benign Het
Osbpl6 T A 2: 76,416,558 (GRCm39) I546K probably damaging Het
Pknox2 A G 9: 36,820,980 (GRCm39) V294A probably damaging Het
Plekha1 T C 7: 130,493,983 (GRCm39) V106A probably benign Het
Plekha6 C A 1: 133,207,103 (GRCm39) probably null Het
Ptgdr A T 14: 45,096,036 (GRCm39) Y225* probably null Het
Ptpn22 A G 3: 103,781,368 (GRCm39) I90V probably damaging Het
Pygb C T 2: 150,658,692 (GRCm39) T372I probably damaging Het
Pzp T C 6: 128,468,124 (GRCm39) probably null Het
Qrich2 C T 11: 116,332,275 (GRCm39) G2307D probably damaging Het
Rfwd3 A T 8: 112,024,034 (GRCm39) V96E probably benign Het
Senp1 T A 15: 97,973,848 (GRCm39) T132S probably benign Het
Slc9a4 T G 1: 40,646,901 (GRCm39) probably null Het
Slfn9 T A 11: 82,872,133 (GRCm39) I868F probably damaging Het
St3gal6 T C 16: 58,296,234 (GRCm39) D137G probably damaging Het
Synj1 G T 16: 90,761,405 (GRCm39) A687D probably damaging Het
Syt4 A G 18: 31,576,496 (GRCm39) probably benign Het
Tacc1 A T 8: 25,654,509 (GRCm39) N271K probably damaging Het
Tdrd6 T C 17: 43,935,724 (GRCm39) T1775A probably benign Het
Tecpr1 T A 5: 144,145,463 (GRCm39) T595S probably benign Het
Tjp3 T A 10: 81,113,888 (GRCm39) M457L possibly damaging Het
Tmem200a T A 10: 25,869,825 (GRCm39) H148L probably damaging Het
Trappc8 A G 18: 20,967,997 (GRCm39) probably null Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ubr4 T A 4: 139,151,256 (GRCm39) M1897K probably damaging Het
Uggt2 A G 14: 119,298,788 (GRCm39) L391P probably damaging Het
Uncx T C 5: 139,533,302 (GRCm39) S456P probably benign Het
Vps13b A G 15: 35,879,937 (GRCm39) Y3004C probably damaging Het
Vps35l T C 7: 118,393,798 (GRCm39) Y516H probably damaging Het
Zbtb46 C T 2: 181,033,224 (GRCm39) C479Y probably damaging Het
Zc3h7a A T 16: 10,968,469 (GRCm39) Y503* probably null Het
Zdhhc13 T A 7: 48,474,392 (GRCm39) L548Q possibly damaging Het
Zfp236 T C 18: 82,639,429 (GRCm39) M1225V probably benign Het
Zfp280d T C 9: 72,215,287 (GRCm39) F133L probably damaging Het
Zfp503 A T 14: 22,035,588 (GRCm39) C443S possibly damaging Het
Zfyve26 T A 12: 79,315,208 (GRCm39) I1423F possibly damaging Het
Other mutations in Pard6g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pard6g APN 18 80,123,037 (GRCm39) splice site probably benign
IGL01514:Pard6g APN 18 80,160,661 (GRCm39) missense probably damaging 1.00
IGL01519:Pard6g APN 18 80,123,071 (GRCm39) missense probably benign 0.34
IGL02305:Pard6g APN 18 80,160,985 (GRCm39) missense probably damaging 1.00
IGL03115:Pard6g APN 18 80,123,068 (GRCm39) missense probably damaging 1.00
R0411:Pard6g UTSW 18 80,160,337 (GRCm39) missense probably damaging 1.00
R0604:Pard6g UTSW 18 80,160,423 (GRCm39) missense probably damaging 1.00
R0938:Pard6g UTSW 18 80,123,259 (GRCm39) nonsense probably null
R1730:Pard6g UTSW 18 80,123,040 (GRCm39) missense probably damaging 0.97
R1783:Pard6g UTSW 18 80,123,040 (GRCm39) missense probably damaging 0.97
R1785:Pard6g UTSW 18 80,160,523 (GRCm39) missense probably damaging 0.96
R1851:Pard6g UTSW 18 80,160,357 (GRCm39) missense probably damaging 1.00
R2070:Pard6g UTSW 18 80,160,940 (GRCm39) missense probably benign 0.00
R2132:Pard6g UTSW 18 80,160,523 (GRCm39) missense probably damaging 0.96
R2133:Pard6g UTSW 18 80,160,523 (GRCm39) missense probably damaging 0.96
R3778:Pard6g UTSW 18 80,123,038 (GRCm39) critical splice acceptor site probably null
R5282:Pard6g UTSW 18 80,123,116 (GRCm39) missense probably benign 0.01
R6084:Pard6g UTSW 18 80,160,420 (GRCm39) missense possibly damaging 0.73
R6913:Pard6g UTSW 18 80,160,534 (GRCm39) missense possibly damaging 0.94
R7124:Pard6g UTSW 18 80,160,340 (GRCm39) missense possibly damaging 0.70
R8109:Pard6g UTSW 18 80,160,658 (GRCm39) missense possibly damaging 0.65
R8469:Pard6g UTSW 18 80,090,347 (GRCm39) missense possibly damaging 0.81
R8903:Pard6g UTSW 18 80,160,411 (GRCm39) nonsense probably null
R8915:Pard6g UTSW 18 80,160,957 (GRCm39) missense probably damaging 0.99
R9077:Pard6g UTSW 18 80,160,772 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCAGCATGCCGCATGACTTC -3'
(R):5'- CTGTGGAATGCACAGAGCTG -3'

Sequencing Primer
(F):5'- GTGTCATCCATCATTGACGTGGAC -3'
(R):5'- ATGCACAGAGCTGCCGGAC -3'
Posted On 2014-06-23