Mutagenetix > Incidental Mutation

Incidental Mutation 'R1799:Rp1'

202879

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h

MMRRC Submission

039829-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R1799 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3999557-4409241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4348832 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 686 (K686E)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027032
AA Change: K686E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: K686E

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208793

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	G	5: 99,234,576	L271P	probably benign	Het
Adamts3	A	C	5: 89,775,421	D175E	probably benign	Het
Adcy4	T	C	14: 55,771,472	T833A	probably benign	Het
Adgrf5	A	T	17: 43,440,067	I508F	probably damaging	Het
AI481877	A	T	4: 59,099,383	V103D	possibly damaging	Het
Arhgap9	G	T	10: 127,327,724	V464L	probably damaging	Het
Atp10a	T	A	7: 58,824,434	D1156E	probably damaging	Het
Atp2a1	A	T	7: 126,450,142	M576K	probably benign	Het
Atrx	T	C	X: 105,847,629	Q1536R	probably damaging	Het
Ccdc141	A	C	2: 77,011,671	V1472G	possibly damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Celsr1	G	T	15: 86,032,685	N362K	probably damaging	Het
Cep290	G	A	10: 100,516,196	A755T	probably benign	Het
Cfap70	T	A	14: 20,394,999	E1071V	probably damaging	Het
Cps1	T	C	1: 67,209,642	V1176A	probably damaging	Het
Csf2rb2	A	C	15: 78,297,068	N41K	probably damaging	Het
Csn1s2a	G	A	5: 87,778,193	V43M	probably damaging	Het
Cyp26b1	T	C	6: 84,584,272	D136G	probably benign	Het
Cyp7b1	A	G	3: 18,097,452	L199P	probably benign	Het
Dapk1	C	T	13: 60,719,654	T225I	probably damaging	Het
Dio2	T	A	12: 90,729,906	T103S	probably benign	Het
Dnhd1	T	A	7: 105,655,767	S339T	probably benign	Het
Drc1	A	G	5: 30,366,497	N737D	probably damaging	Het
Efhc1	C	T	1: 20,979,538	P541S	probably benign	Het
Elmo2	A	T	2: 165,292,157	I637N	probably damaging	Het
Eps15	T	A	4: 109,382,837	D492E	probably damaging	Het
Ermn	G	T	2: 58,048,237	N121K	probably benign	Het
F5	A	G	1: 164,193,531	T1192A	possibly damaging	Het
Fam69a	C	A	5: 107,909,847	V237F	probably damaging	Het
Fbxo22	T	C	9: 55,223,487	F347L	probably benign	Het
Fbxw15	G	A	9: 109,558,246	S227F	probably damaging	Het
Foxj3	A	G	4: 119,619,351	N242S	probably benign	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Grm4	A	G	17: 27,472,940	V235A	probably damaging	Het
Gstm4	T	C	3: 108,043,558	N74S	probably damaging	Het
Gtf3c3	A	G	1: 54,420,424	V393A	possibly damaging	Het
Hltf	T	A	3: 20,105,691	L702H	probably damaging	Het
Inpp4a	T	A	1: 37,392,978	V153E	possibly damaging	Het
Kmt5c	T	C	7: 4,742,730		probably null	Het
Kynu	A	G	2: 43,604,157	R201G	possibly damaging	Het
Lrp2	T	A	2: 69,503,530	T1456S	probably benign	Het
Lrrc40	G	A	3: 158,036,804	V19I	probably benign	Het
M1ap	T	A	6: 83,005,510	C258*	probably null	Het
Man2a1	C	T	17: 64,669,497	R427W	probably damaging	Het
Man2a1	T	C	17: 64,752,457	L1113P	probably benign	Het
Meikin	C	A	11: 54,417,787	Q404K	probably benign	Het
Mfsd4a	T	C	1: 132,053,596	I222V	possibly damaging	Het
Mpp6	T	A	6: 50,196,545	M463K	probably damaging	Het
N4bp2	A	G	5: 65,806,825	N739S	possibly damaging	Het
Ncoa2	A	T	1: 13,162,293		probably null	Het
Nisch	G	T	14: 31,177,271		probably benign	Het
Nmur2	A	G	11: 56,029,621	V266A	probably damaging	Het
Npcd	G	A	15: 79,828,786	R147C	probably damaging	Het
Olfr209	T	A	16: 59,361,880	I113F	probably benign	Het
Olfr735	T	A	14: 50,346,080	M121L	probably benign	Het
Parp4	A	T	14: 56,648,132	H1556L	unknown	Het
Pcdh9	G	T	14: 93,888,671	A21E	probably benign	Het
Phtf1	A	G	3: 103,996,642	E436G	probably benign	Het
Piezo2	C	A	18: 63,032,840		probably null	Het
Piezo2	T	C	18: 63,108,087	Y690C	probably damaging	Het
Pla2g4f	T	C	2: 120,311,068	R183G	possibly damaging	Het
Plxnd1	T	C	6: 115,994,057	D250G	probably damaging	Het
Ppig	A	G	2: 69,749,400	D426G	unknown	Het
Ppp3cb	T	C	14: 20,524,472	E185G	possibly damaging	Het
Qsox1	A	T	1: 155,794,618	M151K	probably null	Het
Ralgapa2	T	C	2: 146,342,728	E1453G	probably benign	Het
Rnf167	G	A	11: 70,650,012	V191I	probably benign	Het
Ryr1	T	G	7: 29,067,621	Q2979P	probably damaging	Het
Scaf1	T	A	7: 45,008,019	I479F	probably damaging	Het
Sept8	A	G	11: 53,534,483	T68A	probably benign	Het
Sh3rf1	A	T	8: 61,372,627	N552I	probably damaging	Het
Slc1a3	A	G	15: 8,688,404	L68P	probably damaging	Het
Slc39a6	G	A	18: 24,585,467	P511L	probably benign	Het
Slc9c1	A	G	16: 45,554,289	Y339C	probably damaging	Het
Smarcal1	G	T	1: 72,585,961	C89F	probably damaging	Het
Smu1	A	T	4: 40,745,537	M261K	probably damaging	Het
Spag8	T	G	4: 43,653,087		probably benign	Het
Spag8	T	C	4: 43,653,345		probably benign	Het
Spata31d1a	T	C	13: 59,703,402	D304G	probably benign	Het
Spdl1	A	T	11: 34,821,029	L298*	probably null	Het
Stac2	C	T	11: 98,039,618		probably null	Het
Stag1	A	G	9: 100,953,462		probably null	Het
Stpg2	C	T	3: 139,419,781	P445L	probably damaging	Het
Sult2a8	A	T	7: 14,423,526	V128E	probably damaging	Het
Synm	A	G	7: 67,735,959	F210L	probably damaging	Het
Tbck	C	G	3: 132,774,502	A714G	probably benign	Het
Tcerg1	A	T	18: 42,560,947	Y711F	possibly damaging	Het
Tnfrsf25	A	G	4: 152,117,008	T98A	probably benign	Het
Togaram2	T	C	17: 71,691,455	S218P	probably damaging	Het
Tpp1	A	T	7: 105,750,308	D84E	probably benign	Het
Trim30d	G	T	7: 104,483,475	Q202K	probably damaging	Het
Trim37	T	A	11: 87,178,019	V397E	probably damaging	Het
Triml1	A	T	8: 43,130,475	I363N	probably damaging	Het
Trpm6	T	A	19: 18,891,999		probably null	Het
Tsc2	T	C	17: 24,604,408	S1055G	probably benign	Het
Ubr5	T	C	15: 37,989,377	D2065G	probably damaging	Het
Uggt2	G	T	14: 119,032,276	P948Q	probably benign	Het
Vps13c	A	T	9: 67,944,117	S2345C	probably damaging	Het
Wtap	G	T	17: 12,980,884	R48S	possibly damaging	Het
Zbtb38	A	G	9: 96,688,881	V50A	probably damaging	Het
Zcchc2	T	A	1: 106,030,287	S829R	probably benign	Het
Zfp385b	T	C	2: 77,415,972	D237G	probably benign	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4346746	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4345403	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4352212	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4345238	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4348945	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4345718	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4348507	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4352522	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4345310	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4347385	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4348780	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4352390	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4349048	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4348450	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4349713	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4346152	nonsense	probably null
IGL03288:Rp1	APN	1	4349524	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4350041	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4344817	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4344628	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4344760	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4347718	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4346747	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4344865	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4346498	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4345352	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4352290	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4344962	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4345936	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4347970	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4347396	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4347694	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4348537	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4345676	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4349201	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4349863	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4345169	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4349089	missense	probably benign	0.00
R1848:Rp1	UTSW	1	4347232	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4348720	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4352671	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4348352	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4348139	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4348027	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4345959	nonsense	probably null
R2316:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4348013	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4348139	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4349765	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4349708	missense	probably benign
R3929:Rp1	UTSW	1	4352645	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4345400	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4347924	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4344663	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4345878	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4349228	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4348675	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4352316	missense	probably damaging	0.99
R4857:Rp1	UTSW	1	4352317	missense	probably damaging	1.00
R5159:Rp1	UTSW	1	4346203	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4348033	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4349360	splice site	probably null
R5352:Rp1	UTSW	1	4347098	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4349890	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4346393	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4345832	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4345237	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4348462	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4148703	missense	unknown
R6004:Rp1	UTSW	1	4197585	missense	unknown
R6018:Rp1	UTSW	1	4352836	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4345379	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4349311	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4349869	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4347254	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4041989	missense	unknown
R6405:Rp1	UTSW	1	4345771	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4226617	missense	unknown
R6466:Rp1	UTSW	1	4347886	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4311280	intron	probably benign
R6547:Rp1	UTSW	1	4170305	missense	unknown
R6604:Rp1	UTSW	1	4019128	missense	unknown
R6700:Rp1	UTSW	1	4349896	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4142664	missense	unknown
R6831:Rp1	UTSW	1	4349864	splice site	probably null
R6918:Rp1	UTSW	1	3999608	missense	unknown
R6973:Rp1	UTSW	1	4351994	nonsense	probably null
R6981:Rp1	UTSW	1	4345655	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4042068	missense	unknown
R7078:Rp1	UTSW	1	4206791	missense	unknown
R7112:Rp1	UTSW	1	4349018	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4348168	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4349917	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4347290	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4228601	missense	unknown
R7367:Rp1	UTSW	1	4347998	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4345481	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4311278	missense	unknown
R7569:Rp1	UTSW	1	4284840	missense	unknown
R7642:Rp1	UTSW	1	4147831	missense	unknown
R7693:Rp1	UTSW	1	4347403	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4170234	missense	unknown
R7759:Rp1	UTSW	1	4344884	missense	probably benign
R7784:Rp1	UTSW	1	4142658	missense	unknown
R7816:Rp1	UTSW	1	4347703	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4347701	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4245095	missense	unknown
R8281:Rp1	UTSW	1	4347916	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4345997	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4347089	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4348349	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4346590	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4349561	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4348784	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4346405	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4024868	missense	unknown
R8859:Rp1	UTSW	1	4349960	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4349594	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4349427	intron	probably benign
R8979:Rp1	UTSW	1	4148714	missense	unknown
R9126:Rp1	UTSW	1	4346913	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4163938	missense	unknown
R9160:Rp1	UTSW	1	4346497	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4245043	missense	unknown
R9263:Rp1	UTSW	1	4348452	missense	probably benign	0.25
R9263:Rp1	UTSW	1	4348937	missense	probably benign	0.02
R9302:Rp1	UTSW	1	4346566	missense	probably damaging	1.00
R9318:Rp1	UTSW	1	4348265	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4243618	missense	unknown
R9474:Rp1	UTSW	1	4092615	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4347322	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4346224	missense	probably benign
R9572:Rp1	UTSW	1	4348439	missense	probably benign
R9673:Rp1	UTSW	1	4267569	missense	unknown
R9709:Rp1	UTSW	1	4042032	missense	unknown
R9716:Rp1	UTSW	1	4142610	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4344694	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4349560	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4347695	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTGCTTACAATCTTTCGTGGCC -3'
(R):5'- GGATCTCCTGTACTCACCATG -3'

Sequencing Primer
(F):5'- ACAATCTTTCGTGGCCTTGATTTTC -3'
(R):5'- CCATGAGACTTGTTAATGAATTTGC -3'

Posted On

2014-06-23