Mutagenetix > Incidental Mutations

Incidental Mutation 'R1799:Adamts3'

202923

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

039829-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1799 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 89775421 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 175 (D175E)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D175E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D175E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930011G23Rik	A	G	5: 99,234,576	L271P	probably benign	Het
Adcy4	T	C	14: 55,771,472	T833A	probably benign	Het
Adgrf5	A	T	17: 43,440,067	I508F	probably damaging	Het
AI481877	A	T	4: 59,099,383	V103D	possibly damaging	Het
Arhgap9	G	T	10: 127,327,724	V464L	probably damaging	Het
Atp10a	T	A	7: 58,824,434	D1156E	probably damaging	Het
Atp2a1	A	T	7: 126,450,142	M576K	probably benign	Het
Atrx	T	C	X: 105,847,629	Q1536R	probably damaging	Het
Ccdc141	A	C	2: 77,011,671	V1472G	possibly damaging	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Celsr1	G	T	15: 86,032,685	N362K	probably damaging	Het
Cep290	G	A	10: 100,516,196	A755T	probably benign	Het
Cfap70	T	A	14: 20,394,999	E1071V	probably damaging	Het
Cps1	T	C	1: 67,209,642	V1176A	probably damaging	Het
Csf2rb2	A	C	15: 78,297,068	N41K	probably damaging	Het
Csn1s2a	G	A	5: 87,778,193	V43M	probably damaging	Het
Cyp26b1	T	C	6: 84,584,272	D136G	probably benign	Het
Cyp7b1	A	G	3: 18,097,452	L199P	probably benign	Het
Dapk1	C	T	13: 60,719,654	T225I	probably damaging	Het
Dio2	T	A	12: 90,729,906	T103S	probably benign	Het
Dnhd1	T	A	7: 105,655,767	S339T	probably benign	Het
Drc1	A	G	5: 30,366,497	N737D	probably damaging	Het
Efhc1	C	T	1: 20,979,538	P541S	probably benign	Het
Elmo2	A	T	2: 165,292,157	I637N	probably damaging	Het
Eps15	T	A	4: 109,382,837	D492E	probably damaging	Het
Ermn	G	T	2: 58,048,237	N121K	probably benign	Het
F5	A	G	1: 164,193,531	T1192A	possibly damaging	Het
Fam69a	C	A	5: 107,909,847	V237F	probably damaging	Het
Fbxo22	T	C	9: 55,223,487	F347L	probably benign	Het
Fbxw15	G	A	9: 109,558,246	S227F	probably damaging	Het
Foxj3	A	G	4: 119,619,351	N242S	probably benign	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Grm4	A	G	17: 27,472,940	V235A	probably damaging	Het
Gstm4	T	C	3: 108,043,558	N74S	probably damaging	Het
Gtf3c3	A	G	1: 54,420,424	V393A	possibly damaging	Het
Hltf	T	A	3: 20,105,691	L702H	probably damaging	Het
Inpp4a	T	A	1: 37,392,978	V153E	possibly damaging	Het
Kmt5c	T	C	7: 4,742,730		probably null	Het
Kynu	A	G	2: 43,604,157	R201G	possibly damaging	Het
Lrp2	T	A	2: 69,503,530	T1456S	probably benign	Het
Lrrc40	G	A	3: 158,036,804	V19I	probably benign	Het
M1ap	T	A	6: 83,005,510	C258*	probably null	Het
Man2a1	C	T	17: 64,669,497	R427W	probably damaging	Het
Man2a1	T	C	17: 64,752,457	L1113P	probably benign	Het
Meikin	C	A	11: 54,417,787	Q404K	probably benign	Het
Mfsd4a	T	C	1: 132,053,596	I222V	possibly damaging	Het
Mpp6	T	A	6: 50,196,545	M463K	probably damaging	Het
N4bp2	A	G	5: 65,806,825	N739S	possibly damaging	Het
Ncoa2	A	T	1: 13,162,293		probably null	Het
Nisch	G	T	14: 31,177,271		probably benign	Het
Nmur2	A	G	11: 56,029,621	V266A	probably damaging	Het
Npcd	G	A	15: 79,828,786	R147C	probably damaging	Het
Olfr209	T	A	16: 59,361,880	I113F	probably benign	Het
Olfr735	T	A	14: 50,346,080	M121L	probably benign	Het
Parp4	A	T	14: 56,648,132	H1556L	unknown	Het
Pcdh9	G	T	14: 93,888,671	A21E	probably benign	Het
Phtf1	A	G	3: 103,996,642	E436G	probably benign	Het
Piezo2	C	A	18: 63,032,840		probably null	Het
Piezo2	T	C	18: 63,108,087	Y690C	probably damaging	Het
Pla2g4f	T	C	2: 120,311,068	R183G	possibly damaging	Het
Plxnd1	T	C	6: 115,994,057	D250G	probably damaging	Het
Ppig	A	G	2: 69,749,400	D426G	unknown	Het
Ppp3cb	T	C	14: 20,524,472	E185G	possibly damaging	Het
Qsox1	A	T	1: 155,794,618	M151K	probably null	Het
Ralgapa2	T	C	2: 146,342,728	E1453G	probably benign	Het
Rnf167	G	A	11: 70,650,012	V191I	probably benign	Het
Rp1	T	C	1: 4,348,832	K686E	possibly damaging	Het
Ryr1	T	G	7: 29,067,621	Q2979P	probably damaging	Het
Scaf1	T	A	7: 45,008,019	I479F	probably damaging	Het
Sept8	A	G	11: 53,534,483	T68A	probably benign	Het
Sh3rf1	A	T	8: 61,372,627	N552I	probably damaging	Het
Slc1a3	A	G	15: 8,688,404	L68P	probably damaging	Het
Slc39a6	G	A	18: 24,585,467	P511L	probably benign	Het
Slc9c1	A	G	16: 45,554,289	Y339C	probably damaging	Het
Smarcal1	G	T	1: 72,585,961	C89F	probably damaging	Het
Smu1	A	T	4: 40,745,537	M261K	probably damaging	Het
Spag8	T	G	4: 43,653,087		probably benign	Het
Spag8	T	C	4: 43,653,345		probably benign	Het
Spata31d1a	T	C	13: 59,703,402	D304G	probably benign	Het
Spdl1	A	T	11: 34,821,029	L298*	probably null	Het
Stac2	C	T	11: 98,039,618		probably null	Het
Stag1	A	G	9: 100,953,462		probably null	Het
Stpg2	C	T	3: 139,419,781	P445L	probably damaging	Het
Sult2a8	A	T	7: 14,423,526	V128E	probably damaging	Het
Synm	A	G	7: 67,735,959	F210L	probably damaging	Het
Tbck	C	G	3: 132,774,502	A714G	probably benign	Het
Tcerg1	A	T	18: 42,560,947	Y711F	possibly damaging	Het
Tnfrsf25	A	G	4: 152,117,008	T98A	probably benign	Het
Togaram2	T	C	17: 71,691,455	S218P	probably damaging	Het
Tpp1	A	T	7: 105,750,308	D84E	probably benign	Het
Trim30d	G	T	7: 104,483,475	Q202K	probably damaging	Het
Trim37	T	A	11: 87,178,019	V397E	probably damaging	Het
Triml1	A	T	8: 43,130,475	I363N	probably damaging	Het
Trpm6	T	A	19: 18,891,999		probably null	Het
Tsc2	T	C	17: 24,604,408	S1055G	probably benign	Het
Ubr5	T	C	15: 37,989,377	D2065G	probably damaging	Het
Uggt2	G	T	14: 119,032,276	P948Q	probably benign	Het
Vps13c	A	T	9: 67,944,117	S2345C	probably damaging	Het
Wtap	G	T	17: 12,980,884	R48S	possibly damaging	Het
Zbtb38	A	G	9: 96,688,881	V50A	probably damaging	Het
Zcchc2	T	A	1: 106,030,287	S829R	probably benign	Het
Zfp385b	T	C	2: 77,415,972	D237G	probably benign	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R7918:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7975:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	not run
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGCTGTCCTGTAAAACTCTGG -3'
(R):5'- ACTCTGGTGAAATGGTTGTATCATG -3'

Sequencing Primer
(F):5'- AAACTCTGGTTACTTAAGCTGCC -3'
(R):5'- TTACAAGGGGTCGCCAAC -3'

Posted On

2014-06-23