Incidental Mutation 'R1799:Adamts3'
ID202923
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms6330442E02Rik, 1100001H14Rik
MMRRC Submission 039829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location89677087-89883334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89775421 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 175 (D175E)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D175E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D175E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89702956
R8468:Adamts3 UTSW 5 89694768
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- AGCTGTCCTGTAAAACTCTGG -3'
(R):5'- ACTCTGGTGAAATGGTTGTATCATG -3'

Sequencing Primer
(F):5'- AAACTCTGGTTACTTAAGCTGCC -3'
(R):5'- TTACAAGGGGTCGCCAAC -3'
Posted On2014-06-23