Incidental Mutation 'R1799:Adamts3'
ID 202923
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 039829-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1799 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 89923280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 175 (D175E)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably benign
Transcript: ENSMUST00000061427
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D175E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: D175E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D175E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,382,435 (GRCm39) L271P probably benign Het
Adcy4 T C 14: 56,008,929 (GRCm39) T833A probably benign Het
Adgrf5 A T 17: 43,750,958 (GRCm39) I508F probably damaging Het
Arhgap9 G T 10: 127,163,593 (GRCm39) V464L probably damaging Het
Atp10a T A 7: 58,474,182 (GRCm39) D1156E probably damaging Het
Atp2a1 A T 7: 126,049,314 (GRCm39) M576K probably benign Het
Atrx T C X: 104,891,235 (GRCm39) Q1536R probably damaging Het
Ccdc141 A C 2: 76,842,015 (GRCm39) V1472G possibly damaging Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Celsr1 G T 15: 85,916,886 (GRCm39) N362K probably damaging Het
Cep290 G A 10: 100,352,058 (GRCm39) A755T probably benign Het
Cfap70 T A 14: 20,445,067 (GRCm39) E1071V probably damaging Het
Cps1 T C 1: 67,248,801 (GRCm39) V1176A probably damaging Het
Csf2rb2 A C 15: 78,181,268 (GRCm39) N41K probably damaging Het
Csn1s2a G A 5: 87,926,052 (GRCm39) V43M probably damaging Het
Cyp26b1 T C 6: 84,561,254 (GRCm39) D136G probably benign Het
Cyp7b1 A G 3: 18,151,616 (GRCm39) L199P probably benign Het
Dapk1 C T 13: 60,867,468 (GRCm39) T225I probably damaging Het
Dio2 T A 12: 90,696,680 (GRCm39) T103S probably benign Het
Dipk1a C A 5: 108,057,713 (GRCm39) V237F probably damaging Het
Dnhd1 T A 7: 105,304,974 (GRCm39) S339T probably benign Het
Drc1 A G 5: 30,523,841 (GRCm39) N737D probably damaging Het
Efhc1 C T 1: 21,049,762 (GRCm39) P541S probably benign Het
Elmo2 A T 2: 165,134,077 (GRCm39) I637N probably damaging Het
Eps15 T A 4: 109,240,034 (GRCm39) D492E probably damaging Het
Ermn G T 2: 57,938,249 (GRCm39) N121K probably benign Het
F5 A G 1: 164,021,100 (GRCm39) T1192A possibly damaging Het
Fbxo22 T C 9: 55,130,771 (GRCm39) F347L probably benign Het
Fbxw15 G A 9: 109,387,314 (GRCm39) S227F probably damaging Het
Foxj3 A G 4: 119,476,548 (GRCm39) N242S probably benign Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Grm4 A G 17: 27,691,914 (GRCm39) V235A probably damaging Het
Gstm4 T C 3: 107,950,874 (GRCm39) N74S probably damaging Het
Gtf3c3 A G 1: 54,459,583 (GRCm39) V393A possibly damaging Het
Hltf T A 3: 20,159,855 (GRCm39) L702H probably damaging Het
Inpp4a T A 1: 37,432,059 (GRCm39) V153E possibly damaging Het
Kmt5c T C 7: 4,745,729 (GRCm39) probably null Het
Kynu A G 2: 43,494,169 (GRCm39) R201G possibly damaging Het
Lrp2 T A 2: 69,333,874 (GRCm39) T1456S probably benign Het
Lrrc40 G A 3: 157,742,441 (GRCm39) V19I probably benign Het
M1ap T A 6: 82,982,491 (GRCm39) C258* probably null Het
Man2a1 T C 17: 65,059,452 (GRCm39) L1113P probably benign Het
Man2a1 C T 17: 64,976,492 (GRCm39) R427W probably damaging Het
Meikin C A 11: 54,308,613 (GRCm39) Q404K probably benign Het
Mfsd4a T C 1: 131,981,334 (GRCm39) I222V possibly damaging Het
N4bp2 A G 5: 65,964,168 (GRCm39) N739S possibly damaging Het
Ncoa2 A T 1: 13,232,517 (GRCm39) probably null Het
Nisch G T 14: 30,899,228 (GRCm39) probably benign Het
Nmur2 A G 11: 55,920,447 (GRCm39) V266A probably damaging Het
Npcd G A 15: 79,712,987 (GRCm39) R147C probably damaging Het
Or4q3 T A 14: 50,583,537 (GRCm39) M121L probably benign Het
Or5ac25 T A 16: 59,182,243 (GRCm39) I113F probably benign Het
Pals2 T A 6: 50,173,525 (GRCm39) M463K probably damaging Het
Parp4 A T 14: 56,885,589 (GRCm39) H1556L unknown Het
Pcdh9 G T 14: 94,126,107 (GRCm39) A21E probably benign Het
Phtf1 A G 3: 103,903,958 (GRCm39) E436G probably benign Het
Piezo2 C A 18: 63,165,911 (GRCm39) probably null Het
Piezo2 T C 18: 63,241,158 (GRCm39) Y690C probably damaging Het
Pla2g4f T C 2: 120,141,549 (GRCm39) R183G possibly damaging Het
Plxnd1 T C 6: 115,971,018 (GRCm39) D250G probably damaging Het
Ppig A G 2: 69,579,744 (GRCm39) D426G unknown Het
Ppp3cb T C 14: 20,574,540 (GRCm39) E185G possibly damaging Het
Qsox1 A T 1: 155,670,364 (GRCm39) M151K probably null Het
Ralgapa2 T C 2: 146,184,648 (GRCm39) E1453G probably benign Het
Rnf167 G A 11: 70,540,838 (GRCm39) V191I probably benign Het
Rp1 T C 1: 4,419,055 (GRCm39) K686E possibly damaging Het
Ryr1 T G 7: 28,767,046 (GRCm39) Q2979P probably damaging Het
Scaf1 T A 7: 44,657,443 (GRCm39) I479F probably damaging Het
Septin8 A G 11: 53,425,310 (GRCm39) T68A probably benign Het
Sh3rf1 A T 8: 61,825,661 (GRCm39) N552I probably damaging Het
Shoc1 A T 4: 59,099,383 (GRCm39) V103D possibly damaging Het
Slc1a3 A G 15: 8,717,888 (GRCm39) L68P probably damaging Het
Slc39a6 G A 18: 24,718,524 (GRCm39) P511L probably benign Het
Slc9c1 A G 16: 45,374,652 (GRCm39) Y339C probably damaging Het
Smarcal1 G T 1: 72,625,120 (GRCm39) C89F probably damaging Het
Smu1 A T 4: 40,745,537 (GRCm39) M261K probably damaging Het
Spag8 T G 4: 43,653,087 (GRCm39) probably benign Het
Spag8 T C 4: 43,653,345 (GRCm39) probably benign Het
Spata31d1a T C 13: 59,851,216 (GRCm39) D304G probably benign Het
Spdl1 A T 11: 34,711,856 (GRCm39) L298* probably null Het
Stac2 C T 11: 97,930,444 (GRCm39) probably null Het
Stag1 A G 9: 100,835,515 (GRCm39) probably null Het
Stpg2 C T 3: 139,125,542 (GRCm39) P445L probably damaging Het
Sult2a8 A T 7: 14,157,451 (GRCm39) V128E probably damaging Het
Synm A G 7: 67,385,707 (GRCm39) F210L probably damaging Het
Tbck C G 3: 132,480,263 (GRCm39) A714G probably benign Het
Tcerg1 A T 18: 42,694,012 (GRCm39) Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,201,465 (GRCm39) T98A probably benign Het
Togaram2 T C 17: 71,998,450 (GRCm39) S218P probably damaging Het
Tpp1 A T 7: 105,399,515 (GRCm39) D84E probably benign Het
Trim30d G T 7: 104,132,682 (GRCm39) Q202K probably damaging Het
Trim37 T A 11: 87,068,845 (GRCm39) V397E probably damaging Het
Triml1 A T 8: 43,583,512 (GRCm39) I363N probably damaging Het
Trpm6 T A 19: 18,869,363 (GRCm39) probably null Het
Tsc2 T C 17: 24,823,382 (GRCm39) S1055G probably benign Het
Ubr5 T C 15: 37,989,621 (GRCm39) D2065G probably damaging Het
Uggt2 G T 14: 119,269,688 (GRCm39) P948Q probably benign Het
Vps13c A T 9: 67,851,399 (GRCm39) S2345C probably damaging Het
Wtap G T 17: 13,199,771 (GRCm39) R48S possibly damaging Het
Zbtb38 A G 9: 96,570,934 (GRCm39) V50A probably damaging Het
Zcchc2 T A 1: 105,958,017 (GRCm39) S829R probably benign Het
Zfp385b T C 2: 77,246,316 (GRCm39) D237G probably benign Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTCCTGTAAAACTCTGG -3'
(R):5'- ACTCTGGTGAAATGGTTGTATCATG -3'

Sequencing Primer
(F):5'- AAACTCTGGTTACTTAAGCTGCC -3'
(R):5'- TTACAAGGGGTCGCCAAC -3'
Posted On 2014-06-23