Incidental Mutation 'R1799:Ubr5'
ID 202972
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Name ubiquitin protein ligase E3 component n-recognin 5
Synonyms Edd, 4432411E13Rik, Edd1
MMRRC Submission 039829-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040
Essential gene? Essential (E-score: 1.000) question?
Stock # R1799 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 37967328-38078854 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37989377 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2065 (D2065G)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110336
AA Change: D2059G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: D2059G

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: D2065G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228292
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
Anchovy UTSW 15 37979832 missense probably null
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
R7166:Ubr5 UTSW 15 37976145 missense
R7514:Ubr5 UTSW 15 37988237 missense
R7523:Ubr5 UTSW 15 38004055 missense
R7631:Ubr5 UTSW 15 38029507 missense
R7709:Ubr5 UTSW 15 37979832 missense probably null
R7710:Ubr5 UTSW 15 37979832 missense probably null
R7712:Ubr5 UTSW 15 37979832 missense probably null
R7803:Ubr5 UTSW 15 37979832 missense probably null
R7816:Ubr5 UTSW 15 37979832 missense probably null
R7817:Ubr5 UTSW 15 37979832 missense probably null
R7821:Ubr5 UTSW 15 37997187 missense probably damaging 0.96
R7824:Ubr5 UTSW 15 37991322 missense probably damaging 0.97
R7841:Ubr5 UTSW 15 37980906 missense
R7869:Ubr5 UTSW 15 37979832 missense probably null
R7896:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R8191:Ubr5 UTSW 15 38006507 missense
R8342:Ubr5 UTSW 15 38024837 missense
R8745:Ubr5 UTSW 15 38024795 missense
R8811:Ubr5 UTSW 15 38040879 missense
R8904:Ubr5 UTSW 15 38041909 missense
R8955:Ubr5 UTSW 15 38029581 missense
R8956:Ubr5 UTSW 15 38015123 missense probably damaging 1.00
R9051:Ubr5 UTSW 15 38002259 missense
R9102:Ubr5 UTSW 15 38018352 missense
R9183:Ubr5 UTSW 15 37997176 missense
R9235:Ubr5 UTSW 15 38045738 missense
R9392:Ubr5 UTSW 15 37984007 missense
R9473:Ubr5 UTSW 15 38002373 missense
R9596:Ubr5 UTSW 15 37985969 missense
R9659:Ubr5 UTSW 15 37984010 missense
R9683:Ubr5 UTSW 15 37978027 missense
RF024:Ubr5 UTSW 15 38028652 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Z1177:Ubr5 UTSW 15 38040755 missense
Predicted Primers PCR Primer
(F):5'- ACTGCGGGGTACATACTCTG -3'
(R):5'- CGACGTTCAGACTCTATGACATTC -3'

Sequencing Primer
(F):5'- CGGGGTACATACTCTGCACTTAATAC -3'
(R):5'- CAGACTCTATGACATTCCTTGGATG -3'
Posted On 2014-06-23