Incidental Mutation 'R1800:Map4k4'
ID202998
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission 039830-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1800 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40023460 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1195 (T1195K)
Ref Sequence ENSEMBL: ENSMUSP00000141400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably damaging
Transcript: ENSMUST00000163854
AA Change: T1195K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: T1195K

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168431
AA Change: T1145K
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: T1145K

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191657
Predicted Effect unknown
Transcript: ENSMUST00000192509
AA Change: T1141K
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: T1141K

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193682
AA Change: T1128K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074
AA Change: T1128K

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195259
AA Change: T1115K
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074
AA Change: T1115K

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195636
AA Change: T1179K
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074
AA Change: T1179K

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195860
AA Change: T1195K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: T1195K

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,718 K556R probably damaging Het
4933406P04Rik A T 10: 20,311,147 probably benign Het
A530099J19Rik T C 13: 19,729,679 noncoding transcript Het
Acmsd C A 1: 127,759,756 Y258* probably null Het
Adgrf5 A T 17: 43,451,082 I1223F probably damaging Het
Afp C T 5: 90,490,796 P6S probably benign Het
Agap2 C A 10: 127,091,671 H1120Q probably damaging Het
Angpt1 A G 15: 42,512,404 V152A probably damaging Het
Ankrd1 A T 19: 36,119,359 F23I probably damaging Het
Armc12 T C 17: 28,538,895 S334P possibly damaging Het
Arnt2 C A 7: 84,275,375 D415Y probably damaging Het
Cacna1s G T 1: 136,076,854 V131L probably benign Het
Cacna2d2 T C 9: 107,527,433 V1141A possibly damaging Het
Cfap61 T C 2: 146,042,622 L580P probably damaging Het
Chga A T 12: 102,555,905 S23C probably damaging Het
Chrna5 A G 9: 55,004,875 T320A probably damaging Het
Col17a1 G T 19: 47,650,862 N1081K possibly damaging Het
Cox7b2 A T 5: 71,443,063 C51S possibly damaging Het
Cwc22 A T 2: 77,929,453 D83E possibly damaging Het
D130043K22Rik A C 13: 24,883,894 D871A probably damaging Het
Dab2 A T 15: 6,435,467 M361L probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnmbp A G 19: 43,901,720 I536T probably benign Het
Ehmt1 A T 2: 24,884,290 S43R probably damaging Het
Ercc5 T C 1: 44,173,380 L666P probably benign Het
F5 A G 1: 164,182,834 H378R probably damaging Het
Fam84a T C 12: 14,150,225 Y167C probably damaging Het
Fat2 A T 11: 55,283,892 N1998K probably damaging Het
Fbxo28 T C 1: 182,341,534 D13G unknown Het
Fras1 T C 5: 96,709,882 S2012P probably benign Het
Gm4758 T A 16: 36,312,533 D57E probably damaging Het
Gm5624 T A 14: 44,561,845 N41I probably damaging Het
Gm6768 A T 12: 119,261,771 noncoding transcript Het
Gm8104 A G 14: 43,101,571 I73V possibly damaging Het
Gpr68 G A 12: 100,878,908 P126S probably damaging Het
Gucy1a2 A T 9: 3,582,685 T156S possibly damaging Het
Hacl1 T A 14: 31,614,264 Y429F probably damaging Het
Haus3 A C 5: 34,163,572 L510R probably damaging Het
Helq C T 5: 100,774,124 G738D probably benign Het
Hsd3b2 G C 3: 98,712,237 P131A probably damaging Het
Il22ra1 G T 4: 135,748,160 C247F probably benign Het
Ivl T C 3: 92,572,584 E58G unknown Het
Kcnk9 G T 15: 72,546,099 Q61K probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Loxhd1 G T 18: 77,402,502 A1314S probably damaging Het
Lrba A G 3: 86,351,868 I1397V probably benign Het
Lrig3 T A 10: 125,997,051 probably null Het
Lrrc36 A G 8: 105,449,765 D378G probably damaging Het
Lrrc49 G A 9: 60,598,191 T527I probably damaging Het
Mrps33 G A 6: 39,802,495 R89C probably damaging Het
Mtor T C 4: 148,462,892 V444A probably benign Het
Myh2 A G 11: 67,188,938 E1046G probably damaging Het
Myo15b G T 11: 115,880,509 probably null Het
Myo5c T C 9: 75,246,164 Y111H probably damaging Het
Ndufv2 G C 17: 66,083,486 T163R probably damaging Het
Nf1 A G 11: 79,553,968 N373S possibly damaging Het
Nwd2 A G 5: 63,805,574 M834V probably benign Het
Ogfod2 T C 5: 124,114,956 V343A probably damaging Het
Olfr1220 T A 2: 89,097,706 T74S probably benign Het
Olfr401 A T 11: 74,121,408 T40S probably benign Het
Olfr597 T A 7: 103,320,414 M1K probably null Het
Olfr610 T C 7: 103,506,041 I302V possibly damaging Het
Olfr736 C A 14: 50,393,329 S191* probably null Het
Olfr744 C T 14: 50,618,686 L155F probably benign Het
Olfr954 A T 9: 39,462,114 I228F probably damaging Het
Parp1 T A 1: 180,600,526 probably null Het
Ppp3ca A T 3: 136,935,031 I448F probably damaging Het
Prss44 T C 9: 110,817,204 V333A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rars A C 11: 35,825,995 D231E probably benign Het
Rfc1 T C 5: 65,264,379 Y1059C probably damaging Het
Rilpl1 T A 5: 124,514,656 I2F probably damaging Het
Sarm1 G T 11: 78,490,994 A221E possibly damaging Het
Serpina3f A G 12: 104,217,406 T176A probably damaging Het
Slc22a20 T C 19: 5,985,667 E131G probably benign Het
Slc26a11 T C 11: 119,373,153 V343A probably damaging Het
Slc2a4 A G 11: 69,946,307 I9T probably benign Het
Slc39a6 G T 18: 24,585,202 D599E probably damaging Het
Slc5a6 G T 5: 31,040,676 S285* probably null Het
Spata9 A G 13: 75,977,641 H81R probably benign Het
St7l A G 3: 104,919,496 E436G probably damaging Het
Tecrl A G 5: 83,279,230 I357T probably damaging Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmprss12 A G 15: 100,292,547 E266G probably benign Het
Tpgs1 T A 10: 79,675,510 V162D possibly damaging Het
Trpa1 C T 1: 14,874,424 R1032Q probably benign Het
Tspan12 A G 6: 21,795,700 Y164H probably damaging Het
Ubr4 T C 4: 139,407,963 Y869H probably damaging Het
Vmn1r21 A G 6: 57,843,814 I215T probably benign Het
Zan A T 5: 137,386,451 S5104T unknown Het
Zfp318 T C 17: 46,412,054 V1661A probably benign Het
Zfp365 C T 10: 67,888,942 R372K probably damaging Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
R7816:Map4k4 UTSW 1 40014208 missense possibly damaging 0.53
R7869:Map4k4 UTSW 1 39974044 missense unknown
R8013:Map4k4 UTSW 1 39962212 missense unknown
R8145:Map4k4 UTSW 1 40000534 missense
R8154:Map4k4 UTSW 1 40021142 nonsense probably null
R8254:Map4k4 UTSW 1 40006675 missense probably damaging 0.99
R8266:Map4k4 UTSW 1 40011653 missense possibly damaging 0.53
R8375:Map4k4 UTSW 1 40024641 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGCGGCACTACCACATTCAC -3'
(R):5'- ATGACTGGGAATTTGTTCCAACC -3'

Sequencing Primer
(F):5'- CTGGACATTCTTGGCTGAGCAC -3'
(R):5'- GACTGGGAATTTGTTCCAACCTTCTC -3'
Posted On2014-06-23