Incidental Mutation 'R1800:Acmsd'
ID203000
Institutional Source Beutler Lab
Gene Symbol Acmsd
Ensembl Gene ENSMUSG00000026348
Gene Nameamino carboxymuconate semialdehyde decarboxylase
Synonyms
MMRRC Submission 039830-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1800 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127729413-127767978 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 127759756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 258 (Y258*)
Ref Sequence ENSEMBL: ENSMUSP00000048482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038006]
Predicted Effect probably null
Transcript: ENSMUST00000038006
AA Change: Y258*
SMART Domains Protein: ENSMUSP00000048482
Gene: ENSMUSG00000026348
AA Change: Y258*

DomainStartEndE-ValueType
Pfam:Amidohydro_2 3 330 7.8e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188163
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase; EC 4.1.1.45) can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,718 K556R probably damaging Het
4933406P04Rik A T 10: 20,311,147 probably benign Het
A530099J19Rik T C 13: 19,729,679 noncoding transcript Het
Adgrf5 A T 17: 43,451,082 I1223F probably damaging Het
Afp C T 5: 90,490,796 P6S probably benign Het
Agap2 C A 10: 127,091,671 H1120Q probably damaging Het
Angpt1 A G 15: 42,512,404 V152A probably damaging Het
Ankrd1 A T 19: 36,119,359 F23I probably damaging Het
Armc12 T C 17: 28,538,895 S334P possibly damaging Het
Arnt2 C A 7: 84,275,375 D415Y probably damaging Het
Cacna1s G T 1: 136,076,854 V131L probably benign Het
Cacna2d2 T C 9: 107,527,433 V1141A possibly damaging Het
Cfap61 T C 2: 146,042,622 L580P probably damaging Het
Chga A T 12: 102,555,905 S23C probably damaging Het
Chrna5 A G 9: 55,004,875 T320A probably damaging Het
Col17a1 G T 19: 47,650,862 N1081K possibly damaging Het
Cox7b2 A T 5: 71,443,063 C51S possibly damaging Het
Cwc22 A T 2: 77,929,453 D83E possibly damaging Het
D130043K22Rik A C 13: 24,883,894 D871A probably damaging Het
Dab2 A T 15: 6,435,467 M361L probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnmbp A G 19: 43,901,720 I536T probably benign Het
Ehmt1 A T 2: 24,884,290 S43R probably damaging Het
Ercc5 T C 1: 44,173,380 L666P probably benign Het
F5 A G 1: 164,182,834 H378R probably damaging Het
Fam84a T C 12: 14,150,225 Y167C probably damaging Het
Fat2 A T 11: 55,283,892 N1998K probably damaging Het
Fbxo28 T C 1: 182,341,534 D13G unknown Het
Fras1 T C 5: 96,709,882 S2012P probably benign Het
Gm4758 T A 16: 36,312,533 D57E probably damaging Het
Gm5624 T A 14: 44,561,845 N41I probably damaging Het
Gm6768 A T 12: 119,261,771 noncoding transcript Het
Gm8104 A G 14: 43,101,571 I73V possibly damaging Het
Gpr68 G A 12: 100,878,908 P126S probably damaging Het
Gucy1a2 A T 9: 3,582,685 T156S possibly damaging Het
Hacl1 T A 14: 31,614,264 Y429F probably damaging Het
Haus3 A C 5: 34,163,572 L510R probably damaging Het
Helq C T 5: 100,774,124 G738D probably benign Het
Hsd3b2 G C 3: 98,712,237 P131A probably damaging Het
Il22ra1 G T 4: 135,748,160 C247F probably benign Het
Ivl T C 3: 92,572,584 E58G unknown Het
Kcnk9 G T 15: 72,546,099 Q61K probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Loxhd1 G T 18: 77,402,502 A1314S probably damaging Het
Lrba A G 3: 86,351,868 I1397V probably benign Het
Lrig3 T A 10: 125,997,051 probably null Het
Lrrc36 A G 8: 105,449,765 D378G probably damaging Het
Lrrc49 G A 9: 60,598,191 T527I probably damaging Het
Map4k4 C A 1: 40,023,460 T1195K probably damaging Het
Mrps33 G A 6: 39,802,495 R89C probably damaging Het
Mtor T C 4: 148,462,892 V444A probably benign Het
Myh2 A G 11: 67,188,938 E1046G probably damaging Het
Myo15b G T 11: 115,880,509 probably null Het
Myo5c T C 9: 75,246,164 Y111H probably damaging Het
Ndufv2 G C 17: 66,083,486 T163R probably damaging Het
Nf1 A G 11: 79,553,968 N373S possibly damaging Het
Nwd2 A G 5: 63,805,574 M834V probably benign Het
Ogfod2 T C 5: 124,114,956 V343A probably damaging Het
Olfr1220 T A 2: 89,097,706 T74S probably benign Het
Olfr401 A T 11: 74,121,408 T40S probably benign Het
Olfr597 T A 7: 103,320,414 M1K probably null Het
Olfr610 T C 7: 103,506,041 I302V possibly damaging Het
Olfr736 C A 14: 50,393,329 S191* probably null Het
Olfr744 C T 14: 50,618,686 L155F probably benign Het
Olfr954 A T 9: 39,462,114 I228F probably damaging Het
Parp1 T A 1: 180,600,526 probably null Het
Ppp3ca A T 3: 136,935,031 I448F probably damaging Het
Prss44 T C 9: 110,817,204 V333A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rars A C 11: 35,825,995 D231E probably benign Het
Rfc1 T C 5: 65,264,379 Y1059C probably damaging Het
Rilpl1 T A 5: 124,514,656 I2F probably damaging Het
Sarm1 G T 11: 78,490,994 A221E possibly damaging Het
Serpina3f A G 12: 104,217,406 T176A probably damaging Het
Slc22a20 T C 19: 5,985,667 E131G probably benign Het
Slc26a11 T C 11: 119,373,153 V343A probably damaging Het
Slc2a4 A G 11: 69,946,307 I9T probably benign Het
Slc39a6 G T 18: 24,585,202 D599E probably damaging Het
Slc5a6 G T 5: 31,040,676 S285* probably null Het
Spata9 A G 13: 75,977,641 H81R probably benign Het
St7l A G 3: 104,919,496 E436G probably damaging Het
Tecrl A G 5: 83,279,230 I357T probably damaging Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmprss12 A G 15: 100,292,547 E266G probably benign Het
Tpgs1 T A 10: 79,675,510 V162D possibly damaging Het
Trpa1 C T 1: 14,874,424 R1032Q probably benign Het
Tspan12 A G 6: 21,795,700 Y164H probably damaging Het
Ubr4 T C 4: 139,407,963 Y869H probably damaging Het
Vmn1r21 A G 6: 57,843,814 I215T probably benign Het
Zan A T 5: 137,386,451 S5104T unknown Het
Zfp318 T C 17: 46,412,054 V1661A probably benign Het
Zfp365 C T 10: 67,888,942 R372K probably damaging Het
Other mutations in Acmsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Acmsd APN 1 127759710 missense probably damaging 1.00
IGL02203:Acmsd APN 1 127738605 splice site probably benign
IGL02209:Acmsd APN 1 127759755 missense probably damaging 1.00
IGL02429:Acmsd APN 1 127759716 missense probably damaging 1.00
IGL02577:Acmsd APN 1 127739959 missense probably benign 0.05
IGL02724:Acmsd APN 1 127749085 missense possibly damaging 0.84
IGL03215:Acmsd APN 1 127758013 nonsense probably null
H8562:Acmsd UTSW 1 127749058 missense probably benign
R0535:Acmsd UTSW 1 127765943 missense probably benign 0.10
R0551:Acmsd UTSW 1 127766333 missense probably benign 0.05
R0593:Acmsd UTSW 1 127738603 splice site probably benign
R1282:Acmsd UTSW 1 127738560 missense probably damaging 0.99
R1633:Acmsd UTSW 1 127753855 missense probably benign 0.33
R3018:Acmsd UTSW 1 127749116 missense probably benign 0.11
R4195:Acmsd UTSW 1 127749194 missense probably damaging 1.00
R4196:Acmsd UTSW 1 127749194 missense probably damaging 1.00
R4288:Acmsd UTSW 1 127738572 missense probably damaging 1.00
R4591:Acmsd UTSW 1 127749197 missense probably damaging 0.99
R5172:Acmsd UTSW 1 127753848 nonsense probably null
R5637:Acmsd UTSW 1 127766313 missense probably damaging 0.99
R6147:Acmsd UTSW 1 127729420 start gained probably benign
R7055:Acmsd UTSW 1 127753833 missense probably benign 0.10
R7261:Acmsd UTSW 1 127759824 missense probably damaging 1.00
R7398:Acmsd UTSW 1 127729435 start gained probably benign
R8030:Acmsd UTSW 1 127749161 missense possibly damaging 0.50
X0067:Acmsd UTSW 1 127759731 missense probably benign 0.42
Z1176:Acmsd UTSW 1 127745802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGCTACATCCAAGCCC -3'
(R):5'- GGCCAAGAGTATGTATTTCAGACA -3'

Sequencing Primer
(F):5'- AAGGTCTCTCGAAAGTTTCCCAGG -3'
(R):5'- CCTTGTCAAGTAGCAGAC -3'
Posted On2014-06-23