Incidental Mutation 'R1800:Nwd2'
ID203022
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 039830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R1800 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63805574 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 834 (M834V)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
Predicted Effect probably benign
Transcript: ENSMUST00000159584
AA Change: M834V

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: M834V

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,718 K556R probably damaging Het
4933406P04Rik A T 10: 20,311,147 probably benign Het
A530099J19Rik T C 13: 19,729,679 noncoding transcript Het
Acmsd C A 1: 127,759,756 Y258* probably null Het
Adgrf5 A T 17: 43,451,082 I1223F probably damaging Het
Afp C T 5: 90,490,796 P6S probably benign Het
Agap2 C A 10: 127,091,671 H1120Q probably damaging Het
Angpt1 A G 15: 42,512,404 V152A probably damaging Het
Ankrd1 A T 19: 36,119,359 F23I probably damaging Het
Armc12 T C 17: 28,538,895 S334P possibly damaging Het
Arnt2 C A 7: 84,275,375 D415Y probably damaging Het
Cacna1s G T 1: 136,076,854 V131L probably benign Het
Cacna2d2 T C 9: 107,527,433 V1141A possibly damaging Het
Cfap61 T C 2: 146,042,622 L580P probably damaging Het
Chga A T 12: 102,555,905 S23C probably damaging Het
Chrna5 A G 9: 55,004,875 T320A probably damaging Het
Col17a1 G T 19: 47,650,862 N1081K possibly damaging Het
Cox7b2 A T 5: 71,443,063 C51S possibly damaging Het
Cwc22 A T 2: 77,929,453 D83E possibly damaging Het
D130043K22Rik A C 13: 24,883,894 D871A probably damaging Het
Dab2 A T 15: 6,435,467 M361L probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnmbp A G 19: 43,901,720 I536T probably benign Het
Ehmt1 A T 2: 24,884,290 S43R probably damaging Het
Ercc5 T C 1: 44,173,380 L666P probably benign Het
F5 A G 1: 164,182,834 H378R probably damaging Het
Fam84a T C 12: 14,150,225 Y167C probably damaging Het
Fat2 A T 11: 55,283,892 N1998K probably damaging Het
Fbxo28 T C 1: 182,341,534 D13G unknown Het
Fras1 T C 5: 96,709,882 S2012P probably benign Het
Gm4758 T A 16: 36,312,533 D57E probably damaging Het
Gm5624 T A 14: 44,561,845 N41I probably damaging Het
Gm6768 A T 12: 119,261,771 noncoding transcript Het
Gm8104 A G 14: 43,101,571 I73V possibly damaging Het
Gpr68 G A 12: 100,878,908 P126S probably damaging Het
Gucy1a2 A T 9: 3,582,685 T156S possibly damaging Het
Hacl1 T A 14: 31,614,264 Y429F probably damaging Het
Haus3 A C 5: 34,163,572 L510R probably damaging Het
Helq C T 5: 100,774,124 G738D probably benign Het
Hsd3b2 G C 3: 98,712,237 P131A probably damaging Het
Il22ra1 G T 4: 135,748,160 C247F probably benign Het
Ivl T C 3: 92,572,584 E58G unknown Het
Kcnk9 G T 15: 72,546,099 Q61K probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Loxhd1 G T 18: 77,402,502 A1314S probably damaging Het
Lrba A G 3: 86,351,868 I1397V probably benign Het
Lrig3 T A 10: 125,997,051 probably null Het
Lrrc36 A G 8: 105,449,765 D378G probably damaging Het
Lrrc49 G A 9: 60,598,191 T527I probably damaging Het
Map4k4 C A 1: 40,023,460 T1195K probably damaging Het
Mrps33 G A 6: 39,802,495 R89C probably damaging Het
Mtor T C 4: 148,462,892 V444A probably benign Het
Myh2 A G 11: 67,188,938 E1046G probably damaging Het
Myo15b G T 11: 115,880,509 probably null Het
Myo5c T C 9: 75,246,164 Y111H probably damaging Het
Ndufv2 G C 17: 66,083,486 T163R probably damaging Het
Nf1 A G 11: 79,553,968 N373S possibly damaging Het
Ogfod2 T C 5: 124,114,956 V343A probably damaging Het
Olfr1220 T A 2: 89,097,706 T74S probably benign Het
Olfr401 A T 11: 74,121,408 T40S probably benign Het
Olfr597 T A 7: 103,320,414 M1K probably null Het
Olfr610 T C 7: 103,506,041 I302V possibly damaging Het
Olfr736 C A 14: 50,393,329 S191* probably null Het
Olfr744 C T 14: 50,618,686 L155F probably benign Het
Olfr954 A T 9: 39,462,114 I228F probably damaging Het
Parp1 T A 1: 180,600,526 probably null Het
Ppp3ca A T 3: 136,935,031 I448F probably damaging Het
Prss44 T C 9: 110,817,204 V333A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rars A C 11: 35,825,995 D231E probably benign Het
Rfc1 T C 5: 65,264,379 Y1059C probably damaging Het
Rilpl1 T A 5: 124,514,656 I2F probably damaging Het
Sarm1 G T 11: 78,490,994 A221E possibly damaging Het
Serpina3f A G 12: 104,217,406 T176A probably damaging Het
Slc22a20 T C 19: 5,985,667 E131G probably benign Het
Slc26a11 T C 11: 119,373,153 V343A probably damaging Het
Slc2a4 A G 11: 69,946,307 I9T probably benign Het
Slc39a6 G T 18: 24,585,202 D599E probably damaging Het
Slc5a6 G T 5: 31,040,676 S285* probably null Het
Spata9 A G 13: 75,977,641 H81R probably benign Het
St7l A G 3: 104,919,496 E436G probably damaging Het
Tecrl A G 5: 83,279,230 I357T probably damaging Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmprss12 A G 15: 100,292,547 E266G probably benign Het
Tpgs1 T A 10: 79,675,510 V162D possibly damaging Het
Trpa1 C T 1: 14,874,424 R1032Q probably benign Het
Tspan12 A G 6: 21,795,700 Y164H probably damaging Het
Ubr4 T C 4: 139,407,963 Y869H probably damaging Het
Vmn1r21 A G 6: 57,843,814 I215T probably benign Het
Zan A T 5: 137,386,451 S5104T unknown Het
Zfp318 T C 17: 46,412,054 V1661A probably benign Het
Zfp365 C T 10: 67,888,942 R372K probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63806157 missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63804984 missense possibly damaging 0.60
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGGAGGAAAGCTTTCTGC -3'
(R):5'- ACCTTGTTTCTGATGCTACGG -3'

Sequencing Primer
(F):5'- AAGCTTTCTGCCTGGAAGAC -3'
(R):5'- TGTGCTGGCCAGGAACTTCAG -3'
Posted On2014-06-23