Mutagenetix > Incidental Mutations

Incidental Mutation 'R1800:Nf1'

203063

Institutional Source

Beutler Lab

Gene Symbol

Nf1

Ensembl Gene

ENSMUSG00000020716

Gene Name

neurofibromin 1

Synonyms

Nf-1, neurofibromin

MMRRC Submission

039830-MU

Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1800 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79339693-79581612 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79553968 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 373 (N373S)

Ref Sequence

ENSEMBL: ENSMUSP00000120982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000137997]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071325
AA Change: N2389S

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: N2389S

Domain	Start	End	E-Value	Type
RasGAP	1189	1559	2.56e-151	SMART
SEC14	1585	1737	2.36e-11	SMART
low complexity region	2619	2629	N/A	INTRINSIC
low complexity region	2750	2763	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108251
AA Change: N2368S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: N2368S

Domain	Start	End	E-Value	Type
RasGAP	1189	1538	1.23e-153	SMART
SEC14	1564	1716	2.36e-11	SMART
low complexity region	2598	2608	N/A	INTRINSIC
low complexity region	2729	2742	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137997
AA Change: N373S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000120982
Gene: ENSMUSG00000020716
AA Change: N373S

Domain	Start	End	E-Value	Type
low complexity region	604	614	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146699

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]

Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,066,718	K556R	probably damaging	Het
4933406P04Rik	A	T	10: 20,311,147		probably benign	Het
A530099J19Rik	T	C	13: 19,729,679		noncoding transcript	Het
Acmsd	C	A	1: 127,759,756	Y258*	probably null	Het
Adgrf5	A	T	17: 43,451,082	I1223F	probably damaging	Het
Afp	C	T	5: 90,490,796	P6S	probably benign	Het
Agap2	C	A	10: 127,091,671	H1120Q	probably damaging	Het
Angpt1	A	G	15: 42,512,404	V152A	probably damaging	Het
Ankrd1	A	T	19: 36,119,359	F23I	probably damaging	Het
Armc12	T	C	17: 28,538,895	S334P	possibly damaging	Het
Arnt2	C	A	7: 84,275,375	D415Y	probably damaging	Het
Cacna1s	G	T	1: 136,076,854	V131L	probably benign	Het
Cacna2d2	T	C	9: 107,527,433	V1141A	possibly damaging	Het
Cfap61	T	C	2: 146,042,622	L580P	probably damaging	Het
Chga	A	T	12: 102,555,905	S23C	probably damaging	Het
Chrna5	A	G	9: 55,004,875	T320A	probably damaging	Het
Col17a1	G	T	19: 47,650,862	N1081K	possibly damaging	Het
Cox7b2	A	T	5: 71,443,063	C51S	possibly damaging	Het
Cwc22	A	T	2: 77,929,453	D83E	possibly damaging	Het
D130043K22Rik	A	C	13: 24,883,894	D871A	probably damaging	Het
Dab2	A	T	15: 6,435,467	M361L	probably benign	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Dnmbp	A	G	19: 43,901,720	I536T	probably benign	Het
Ehmt1	A	T	2: 24,884,290	S43R	probably damaging	Het
Ercc5	T	C	1: 44,173,380	L666P	probably benign	Het
F5	A	G	1: 164,182,834	H378R	probably damaging	Het
Fam84a	T	C	12: 14,150,225	Y167C	probably damaging	Het
Fat2	A	T	11: 55,283,892	N1998K	probably damaging	Het
Fbxo28	T	C	1: 182,341,534	D13G	unknown	Het
Fras1	T	C	5: 96,709,882	S2012P	probably benign	Het
Gm4758	T	A	16: 36,312,533	D57E	probably damaging	Het
Gm5624	T	A	14: 44,561,845	N41I	probably damaging	Het
Gm6768	A	T	12: 119,261,771		noncoding transcript	Het
Gm8104	A	G	14: 43,101,571	I73V	possibly damaging	Het
Gpr68	G	A	12: 100,878,908	P126S	probably damaging	Het
Gucy1a2	A	T	9: 3,582,685	T156S	possibly damaging	Het
Hacl1	T	A	14: 31,614,264	Y429F	probably damaging	Het
Haus3	A	C	5: 34,163,572	L510R	probably damaging	Het
Helq	C	T	5: 100,774,124	G738D	probably benign	Het
Hsd3b2	G	C	3: 98,712,237	P131A	probably damaging	Het
Il22ra1	G	T	4: 135,748,160	C247F	probably benign	Het
Ivl	T	C	3: 92,572,584	E58G	unknown	Het
Kcnk9	G	T	15: 72,546,099	Q61K	probably benign	Het
Kremen1	CGGG	CGGGGGG	11: 5,201,791		probably benign	Het
Loxhd1	G	T	18: 77,402,502	A1314S	probably damaging	Het
Lrba	A	G	3: 86,351,868	I1397V	probably benign	Het
Lrig3	T	A	10: 125,997,051		probably null	Het
Lrrc36	A	G	8: 105,449,765	D378G	probably damaging	Het
Lrrc49	G	A	9: 60,598,191	T527I	probably damaging	Het
Map4k4	C	A	1: 40,023,460	T1195K	probably damaging	Het
Mrps33	G	A	6: 39,802,495	R89C	probably damaging	Het
Mtor	T	C	4: 148,462,892	V444A	probably benign	Het
Myh2	A	G	11: 67,188,938	E1046G	probably damaging	Het
Myo15b	G	T	11: 115,880,509		probably null	Het
Myo5c	T	C	9: 75,246,164	Y111H	probably damaging	Het
Ndufv2	G	C	17: 66,083,486	T163R	probably damaging	Het
Nwd2	A	G	5: 63,805,574	M834V	probably benign	Het
Ogfod2	T	C	5: 124,114,956	V343A	probably damaging	Het
Olfr1220	T	A	2: 89,097,706	T74S	probably benign	Het
Olfr401	A	T	11: 74,121,408	T40S	probably benign	Het
Olfr597	T	A	7: 103,320,414	M1K	probably null	Het
Olfr610	T	C	7: 103,506,041	I302V	possibly damaging	Het
Olfr736	C	A	14: 50,393,329	S191*	probably null	Het
Olfr744	C	T	14: 50,618,686	L155F	probably benign	Het
Olfr954	A	T	9: 39,462,114	I228F	probably damaging	Het
Parp1	T	A	1: 180,600,526		probably null	Het
Ppp3ca	A	T	3: 136,935,031	I448F	probably damaging	Het
Prss44	T	C	9: 110,817,204	V333A	probably damaging	Het
Pxk	C	T	14: 8,151,507	R441*	probably null	Het
Rars	A	C	11: 35,825,995	D231E	probably benign	Het
Rfc1	T	C	5: 65,264,379	Y1059C	probably damaging	Het
Rilpl1	T	A	5: 124,514,656	I2F	probably damaging	Het
Sarm1	G	T	11: 78,490,994	A221E	possibly damaging	Het
Serpina3f	A	G	12: 104,217,406	T176A	probably damaging	Het
Slc22a20	T	C	19: 5,985,667	E131G	probably benign	Het
Slc26a11	T	C	11: 119,373,153	V343A	probably damaging	Het
Slc2a4	A	G	11: 69,946,307	I9T	probably benign	Het
Slc39a6	G	T	18: 24,585,202	D599E	probably damaging	Het
Slc5a6	G	T	5: 31,040,676	S285*	probably null	Het
Spata9	A	G	13: 75,977,641	H81R	probably benign	Het
St7l	A	G	3: 104,919,496	E436G	probably damaging	Het
Tecrl	A	G	5: 83,279,230	I357T	probably damaging	Het
Thop1	C	T	10: 81,073,209	R25C	probably damaging	Het
Tmprss12	A	G	15: 100,292,547	E266G	probably benign	Het
Tpgs1	T	A	10: 79,675,510	V162D	possibly damaging	Het
Trpa1	C	T	1: 14,874,424	R1032Q	probably benign	Het
Tspan12	A	G	6: 21,795,700	Y164H	probably damaging	Het
Ubr4	T	C	4: 139,407,963	Y869H	probably damaging	Het
Vmn1r21	A	G	6: 57,843,814	I215T	probably benign	Het
Zan	A	T	5: 137,386,451	S5104T	unknown	Het
Zfp318	T	C	17: 46,412,054	V1661A	probably benign	Het
Zfp365	C	T	10: 67,888,942	R372K	probably damaging	Het

Other mutations in Nf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00225:Nf1	APN	11	79395905	missense	probably damaging	0.99
IGL00801:Nf1	APN	11	79428700	splice site	probably benign
IGL00823:Nf1	APN	11	79565517	missense	probably damaging	1.00
IGL00945:Nf1	APN	11	79469803	missense	probably damaging	0.99
IGL00960:Nf1	APN	11	79445121	missense	probably damaging	1.00
IGL01118:Nf1	APN	11	79546986	missense	probably damaging	0.99
IGL01604:Nf1	APN	11	79441709	splice site	probably benign
IGL01637:Nf1	APN	11	79547120	missense	probably damaging	1.00
IGL01659:Nf1	APN	11	79559449	missense	probably benign
IGL01764:Nf1	APN	11	79384187	missense	probably benign
IGL01772:Nf1	APN	11	79390249	missense	probably damaging	1.00
IGL02047:Nf1	APN	11	79425535	missense	probably benign	0.04
IGL02052:Nf1	APN	11	79412727	missense	probably damaging	1.00
IGL02071:Nf1	APN	11	79444121	missense	possibly damaging	0.96
IGL02312:Nf1	APN	11	79444648	missense	possibly damaging	0.95
IGL02341:Nf1	APN	11	79564926	missense	probably benign	0.33
IGL02390:Nf1	APN	11	79565935	missense	possibly damaging	0.64
IGL02390:Nf1	APN	11	79411676	splice site	probably benign
IGL02475:Nf1	APN	11	79535667	missense	probably damaging	1.00
IGL02567:Nf1	APN	11	79547143	missense	probably damaging	1.00
IGL02571:Nf1	APN	11	79428627	missense	probably damaging	1.00
IGL02664:Nf1	APN	11	79444598	critical splice acceptor site	probably null
IGL02664:Nf1	APN	11	79444599	critical splice acceptor site	probably null
IGL02992:Nf1	APN	11	79434933	splice site	probably benign
IGL03006:Nf1	APN	11	79545431	missense	probably damaging	1.00
IGL03216:Nf1	APN	11	79564895	missense	probably benign	0.17
Diesel	UTSW	11	79556723	missense	probably damaging	0.96
Franklin	UTSW	11	79473320	splice site	probably null
Gasoline	UTSW	11	79556789	missense	probably benign	0.17
hancock	UTSW	11	79536850	missense	probably benign
jackson	UTSW	11	79447572	missense	probably damaging	1.00
Jefferson	UTSW	11	79446864	missense	probably damaging	1.00
Phyletic_dwarf	UTSW	11	79454189	missense	probably damaging	1.00
C9142:Nf1	UTSW	11	79556731	missense	probably damaging	0.98
I2289:Nf1	UTSW	11	79547776	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0055:Nf1	UTSW	11	79471551	missense	probably damaging	1.00
R0081:Nf1	UTSW	11	79453979	splice site	probably benign
R0115:Nf1	UTSW	11	79468876	critical splice donor site	probably null
R0144:Nf1	UTSW	11	79547127	missense	probably damaging	1.00
R0196:Nf1	UTSW	11	79468769	missense	possibly damaging	0.94
R0196:Nf1	UTSW	11	79578272	missense	probably damaging	1.00
R0217:Nf1	UTSW	11	79428574	splice site	probably benign
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0238:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0239:Nf1	UTSW	11	79418574	missense	possibly damaging	0.89
R0255:Nf1	UTSW	11	79408699	splice site	probably null
R0362:Nf1	UTSW	11	79536878	missense	probably damaging	1.00
R0364:Nf1	UTSW	11	79441957	nonsense	probably null
R0464:Nf1	UTSW	11	79556789	missense	probably benign	0.17
R0511:Nf1	UTSW	11	79438769	missense	probably benign	0.01
R0549:Nf1	UTSW	11	79468771	missense	probably damaging	0.99
R0585:Nf1	UTSW	11	79568701	missense	probably damaging	0.99
R0636:Nf1	UTSW	11	79535703	missense	probably damaging	0.99
R0924:Nf1	UTSW	11	79453866	missense	probably damaging	0.98
R0942:Nf1	UTSW	11	79438711	missense	probably benign	0.00
R1022:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1024:Nf1	UTSW	11	79547033	missense	probably damaging	1.00
R1350:Nf1	UTSW	11	79412687	missense	probably damaging	1.00
R1365:Nf1	UTSW	11	79547885	splice site	probably null
R1395:Nf1	UTSW	11	79535983	missense	possibly damaging	0.49
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1467:Nf1	UTSW	11	79428626	missense	possibly damaging	0.88
R1477:Nf1	UTSW	11	79395859	nonsense	probably null
R1508:Nf1	UTSW	11	79440909	missense	probably damaging	1.00
R1512:Nf1	UTSW	11	79390369	missense	probably damaging	1.00
R1605:Nf1	UTSW	11	79440923	missense	probably benign	0.01
R1680:Nf1	UTSW	11	79550998	nonsense	probably null
R1704:Nf1	UTSW	11	79463301	splice site	probably null
R1707:Nf1	UTSW	11	79535604	missense	probably damaging	1.00
R1741:Nf1	UTSW	11	79443931	missense	probably benign
R1761:Nf1	UTSW	11	79384265	missense	probably damaging	1.00
R1873:Nf1	UTSW	11	79547161	missense	probably damaging	1.00
R1966:Nf1	UTSW	11	79411564	missense	possibly damaging	0.72
R1967:Nf1	UTSW	11	79412745	missense	probably damaging	0.96
R1970:Nf1	UTSW	11	79553961	missense	probably benign	0.08
R2059:Nf1	UTSW	11	79556723	missense	probably damaging	0.96
R2105:Nf1	UTSW	11	79469826	missense	possibly damaging	0.50
R2151:Nf1	UTSW	11	79447570	missense	possibly damaging	0.94
R2211:Nf1	UTSW	11	79444064	missense	probably benign	0.39
R2497:Nf1	UTSW	11	79443884	missense	probably damaging	1.00
R2899:Nf1	UTSW	11	79412758	missense	possibly damaging	0.93
R3086:Nf1	UTSW	11	79546986	missense	probably damaging	1.00
R3120:Nf1	UTSW	11	79564899	missense	probably damaging	0.99
R3744:Nf1	UTSW	11	79548747	missense	probably benign	0.23
R3801:Nf1	UTSW	11	79559521	missense	probably null	0.98
R3804:Nf1	UTSW	11	79559521	missense	probably null	0.98
R4212:Nf1	UTSW	11	79469798	missense	probably damaging	1.00
R4298:Nf1	UTSW	11	79384244	missense	probably damaging	1.00
R4578:Nf1	UTSW	11	79445759	missense	probably damaging	1.00
R4579:Nf1	UTSW	11	79468757	missense	probably damaging	1.00
R4587:Nf1	UTSW	11	79536037	critical splice donor site	probably null
R4793:Nf1	UTSW	11	79447572	missense	probably damaging	1.00
R4834:Nf1	UTSW	11	79546297	missense	probably damaging	1.00
R4863:Nf1	UTSW	11	79409409	missense	probably damaging	1.00
R4967:Nf1	UTSW	11	79565553	critical splice donor site	probably null
R4971:Nf1	UTSW	11	79444643	missense	probably damaging	1.00
R5034:Nf1	UTSW	11	79444150	missense	probably damaging	0.98
R5036:Nf1	UTSW	11	79446864	missense	probably damaging	1.00
R5207:Nf1	UTSW	11	79454189	missense	probably damaging	1.00
R5348:Nf1	UTSW	11	79564899	missense	probably damaging	1.00
R5356:Nf1	UTSW	11	79473456	missense	possibly damaging	0.94
R5444:Nf1	UTSW	11	79443959	missense	possibly damaging	0.94
R5533:Nf1	UTSW	11	79445789	missense	probably damaging	0.99
R5918:Nf1	UTSW	11	79569222	intron	probably benign
R5978:Nf1	UTSW	11	79540419	missense	probably damaging	1.00
R6140:Nf1	UTSW	11	79473320	splice site	probably null
R6195:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6216:Nf1	UTSW	11	79411607	missense	possibly damaging	0.93
R6233:Nf1	UTSW	11	79565975	missense	probably damaging	0.99
R6257:Nf1	UTSW	11	79549491	missense	probably damaging	1.00
R6258:Nf1	UTSW	11	79565755	splice site	probably null
R6756:Nf1	UTSW	11	79444587	splice site	probably null
R6878:Nf1	UTSW	11	79434882	missense	probably damaging	1.00
R6959:Nf1	UTSW	11	79549468	missense	probably damaging	0.98
R7007:Nf1	UTSW	11	79447023	splice site	probably null
R7066:Nf1	UTSW	11	79556720	missense	probably damaging	1.00
R7099:Nf1	UTSW	11	79570330	missense	probably benign	0.08
R7213:Nf1	UTSW	11	79469819	missense	probably benign	0.23
R7326:Nf1	UTSW	11	79564943	missense	probably benign
R7348:Nf1	UTSW	11	79536850	missense	probably benign
R7380:Nf1	UTSW	11	79546276	missense	probably damaging	1.00
R7407:Nf1	UTSW	11	79448143	missense	probably damaging	1.00
R7412:Nf1	UTSW	11	79473414	missense	probably damaging	1.00
R7545:Nf1	UTSW	11	79409524	missense	probably benign
R7567:Nf1	UTSW	11	79547226	missense	probably damaging	0.99
R7574:Nf1	UTSW	11	79408769	missense	probably null	0.99
R7616:Nf1	UTSW	11	79384266	missense	probably damaging	0.97
R7713:Nf1	UTSW	11	79425606	missense	probably benign
R7737:Nf1	UTSW	11	79545488	missense	probably benign	0.33
R7869:Nf1	UTSW	11	79418588	missense	probably damaging	1.00
R7905:Nf1	UTSW	11	79547112	missense	possibly damaging	0.80
R8232:Nf1	UTSW	11	79578331	missense	probably damaging	0.96
R8244:Nf1	UTSW	11	79440924	missense	probably benign
R8397:Nf1	UTSW	11	79547692	missense	probably damaging	1.00
R8436:Nf1	UTSW	11	79458883	missense	probably damaging	0.99
R8492:Nf1	UTSW	11	79408422	missense	probably benign	0.06
X0052:Nf1	UTSW	11	79559416	missense	probably damaging	0.99
Z1177:Nf1	UTSW	11	79564925	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGGGTTCTAGTACTGGAAAAC -3'
(R):5'- CACAGCAATTAAGTCTTGGGG -3'

Sequencing Primer
(F):5'- CGAGAAGGAAAATTTCTGTGCG -3'
(R):5'- GTCTTGGGGGAATTTTACTACTAAC -3'

Posted On

2014-06-23