Incidental Mutation 'R0092:Krt13'
ID 20307
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Name keratin 13
Synonyms Krt1-13, K13, Krt-1.13
MMRRC Submission 038379-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R0092 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 100008153-100012392 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 100012258 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 22 (Q22*)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
AlphaFold P08730
Predicted Effect probably null
Transcript: ENSMUST00000007275
AA Change: Q22*
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: Q22*

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,662,762 (GRCm39) S535T probably benign Het
Acad11 A T 9: 103,967,540 (GRCm39) probably benign Het
Acadm A T 3: 153,647,512 (GRCm39) probably benign Het
Acot12 T A 13: 91,889,684 (GRCm39) M12K probably damaging Het
Actr2 A T 11: 20,044,308 (GRCm39) N99K probably benign Het
Adam2 G A 14: 66,291,336 (GRCm39) A314V probably damaging Het
Agl C T 3: 116,587,453 (GRCm39) R34Q probably damaging Het
Agrn C T 4: 156,263,410 (GRCm39) R338H probably damaging Het
AI661453 A G 17: 47,778,440 (GRCm39) probably benign Het
Alpk3 A G 7: 80,742,301 (GRCm39) D706G probably benign Het
Apbb1 T C 7: 105,208,361 (GRCm39) E648G probably damaging Het
Astn2 C A 4: 66,322,219 (GRCm39) A127S unknown Het
Asxl2 T C 12: 3,546,313 (GRCm39) S366P probably benign Het
Bdh1 A T 16: 31,266,380 (GRCm39) K92* probably null Het
Bltp1 A G 3: 37,082,308 (GRCm39) D3790G probably benign Het
Cacna1g C T 11: 94,348,090 (GRCm39) S666N probably damaging Het
Ces2b A G 8: 105,563,144 (GRCm39) T361A possibly damaging Het
Col6a4 T A 9: 105,890,513 (GRCm39) E1927V probably benign Het
Ctnnb1 T G 9: 120,781,929 (GRCm39) I314S possibly damaging Het
Cyp2c66 T C 19: 39,172,224 (GRCm39) probably benign Het
Dennd4c T A 4: 86,699,844 (GRCm39) F232I probably damaging Het
Dennd5a T C 7: 109,499,013 (GRCm39) N950S possibly damaging Het
Dhx30 T C 9: 109,914,078 (GRCm39) N14S possibly damaging Het
Dip2b T A 15: 100,100,146 (GRCm39) V1004D probably damaging Het
Dnah1 A C 14: 30,993,566 (GRCm39) S2872A probably benign Het
Dnajc10 T C 2: 80,156,026 (GRCm39) V233A probably damaging Het
E230025N22Rik A G 18: 36,822,277 (GRCm39) L162P probably damaging Het
Elmod3 T C 6: 72,543,792 (GRCm39) D333G probably benign Het
Epb41l3 T A 17: 69,593,745 (GRCm39) M846K probably damaging Het
Frem2 A G 3: 53,497,217 (GRCm39) Y1766H probably benign Het
Fxr2 T C 11: 69,532,972 (GRCm39) probably benign Het
Gmpr2 A G 14: 55,915,402 (GRCm39) R258G probably benign Het
Helb T C 10: 119,925,713 (GRCm39) Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,001,899 (GRCm39) probably null Het
Hipk2 T C 6: 38,720,164 (GRCm39) D482G probably damaging Het
Itgb4 G T 11: 115,869,950 (GRCm39) R44L probably damaging Het
Itih1 T C 14: 30,662,820 (GRCm39) probably benign Het
Kit T A 5: 75,808,414 (GRCm39) S719R possibly damaging Het
L3mbtl4 A C 17: 68,732,698 (GRCm39) R59S probably benign Het
Lpp A G 16: 24,580,352 (GRCm39) S23G probably benign Het
Magi3 G A 3: 103,958,280 (GRCm39) Q602* probably null Het
Man2a1 A G 17: 64,966,079 (GRCm39) probably benign Het
Muc5ac A G 7: 141,372,367 (GRCm39) E2667G possibly damaging Het
Myef2l G A 3: 10,153,633 (GRCm39) C134Y possibly damaging Het
Myo15b C G 11: 115,753,812 (GRCm39) S842C possibly damaging Het
Naf1 T A 8: 67,341,760 (GRCm39) S462T probably benign Het
Necab3 T C 2: 154,400,659 (GRCm39) D34G possibly damaging Het
Nisch C A 14: 30,913,410 (GRCm39) probably benign Het
Nlrc5 T C 8: 95,216,222 (GRCm39) probably benign Het
Nmt1 T C 11: 102,937,319 (GRCm39) F119L probably damaging Het
Nod1 T G 6: 54,921,526 (GRCm39) D264A probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nt5e T A 9: 88,252,338 (GRCm39) F567I probably benign Het
Obscn A T 11: 58,942,073 (GRCm39) M4434K possibly damaging Het
Opa1 A T 16: 29,444,412 (GRCm39) D866V probably damaging Het
Or10a3m T C 7: 108,313,031 (GRCm39) V145A probably benign Het
Or10al3 T G 17: 38,011,696 (GRCm39) L45R probably damaging Het
Or10p1 A G 10: 129,444,090 (GRCm39) S87P probably damaging Het
Or1j21 A G 2: 36,683,508 (GRCm39) T87A probably benign Het
Or51ai2 T C 7: 103,586,934 (GRCm39) S116P probably damaging Het
Otop1 T A 5: 38,457,174 (GRCm39) V311E probably damaging Het
Pcsk2 A G 2: 143,642,944 (GRCm39) D407G probably damaging Het
Pdcd1 A G 1: 93,980,149 (GRCm39) W23R possibly damaging Het
Pigp A G 16: 94,166,321 (GRCm39) V129A probably damaging Het
Pik3r5 A G 11: 68,383,629 (GRCm39) R483G probably benign Het
Pink1 A G 4: 138,047,309 (GRCm39) V225A probably benign Het
Plcl1 C G 1: 55,735,924 (GRCm39) Q422E probably damaging Het
Plec T C 15: 76,067,943 (GRCm39) E1222G probably benign Het
Polr1a T C 6: 71,944,439 (GRCm39) probably benign Het
Prokr2 C T 2: 132,215,517 (GRCm39) V154M probably damaging Het
Rasgrp4 A G 7: 28,844,557 (GRCm39) R280G possibly damaging Het
Rmnd5b T C 11: 51,520,419 (GRCm39) E8G possibly damaging Het
Sbf2 T A 7: 109,920,013 (GRCm39) probably benign Het
Sec23b A G 2: 144,408,830 (GRCm39) M172V probably benign Het
Setx T C 2: 29,036,305 (GRCm39) V930A probably benign Het
Sft2d2 G A 1: 165,006,829 (GRCm39) A159V possibly damaging Het
Sh3gl1 G T 17: 56,325,088 (GRCm39) R250S probably benign Het
Skor1 C A 9: 63,053,277 (GRCm39) D231Y probably damaging Het
Slc24a1 T G 9: 64,856,034 (GRCm39) E291A unknown Het
Slc28a2b G T 2: 122,348,078 (GRCm39) probably benign Het
Smc1b A T 15: 84,951,925 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,644,844 (GRCm39) N177K possibly damaging Het
Tdp1 T A 12: 99,921,248 (GRCm39) Y595N probably damaging Het
Tle5 G A 10: 81,397,054 (GRCm39) G10D possibly damaging Het
Tmem108 T C 9: 103,366,504 (GRCm39) K496E possibly damaging Het
Tmprss7 T C 16: 45,487,959 (GRCm39) D490G probably damaging Het
Tnrc6b A T 15: 80,802,729 (GRCm39) N1511Y probably damaging Het
Top2b G A 14: 16,409,263 (GRCm38) R802Q probably damaging Het
Trip10 A T 17: 57,557,798 (GRCm39) K27N possibly damaging Het
Txlnb A G 10: 17,718,503 (GRCm39) N445D possibly damaging Het
Txnrd1 T A 10: 82,715,636 (GRCm39) I159N probably damaging Het
Ulk1 C A 5: 110,944,193 (GRCm39) A164S probably null Het
Vmn2r83 T C 10: 79,327,798 (GRCm39) V802A probably damaging Het
Zbtb4 A G 11: 69,670,177 (GRCm39) I967V probably benign Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100,010,539 (GRCm39) missense probably damaging 1.00
IGL02532:Krt13 APN 11 100,010,195 (GRCm39) missense probably damaging 1.00
IGL02934:Krt13 APN 11 100,009,910 (GRCm39) missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100,010,862 (GRCm39) missense probably damaging 0.98
R0722:Krt13 UTSW 11 100,009,979 (GRCm39) missense probably damaging 1.00
R1228:Krt13 UTSW 11 100,012,303 (GRCm39) missense probably benign 0.18
R1400:Krt13 UTSW 11 100,012,110 (GRCm39) missense probably damaging 1.00
R1751:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100,011,926 (GRCm39) missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2421:Krt13 UTSW 11 100,010,877 (GRCm39) missense probably benign 0.43
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R2869:Krt13 UTSW 11 100,008,475 (GRCm39) missense unknown
R4421:Krt13 UTSW 11 100,009,761 (GRCm39) missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100,008,827 (GRCm39) missense unknown
R4520:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
R4632:Krt13 UTSW 11 100,012,050 (GRCm39) missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100,010,189 (GRCm39) missense probably damaging 1.00
R4872:Krt13 UTSW 11 100,012,332 (GRCm39) start gained probably benign
R5709:Krt13 UTSW 11 100,008,469 (GRCm39) missense unknown
R6014:Krt13 UTSW 11 100,008,437 (GRCm39) missense unknown
R6323:Krt13 UTSW 11 100,011,976 (GRCm39) missense probably damaging 1.00
R6391:Krt13 UTSW 11 100,010,202 (GRCm39) missense probably damaging 0.96
R7535:Krt13 UTSW 11 100,008,824 (GRCm39) missense unknown
R7562:Krt13 UTSW 11 100,010,162 (GRCm39) missense probably damaging 1.00
R7867:Krt13 UTSW 11 100,012,008 (GRCm39) missense probably damaging 1.00
R7992:Krt13 UTSW 11 100,008,478 (GRCm39) missense unknown
R8379:Krt13 UTSW 11 100,009,706 (GRCm39) missense probably damaging 0.99
R8429:Krt13 UTSW 11 100,011,951 (GRCm39) missense probably damaging 1.00
R8560:Krt13 UTSW 11 100,009,676 (GRCm39) missense possibly damaging 0.85
R8728:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably null 0.73
R8879:Krt13 UTSW 11 100,010,211 (GRCm39) missense probably benign 0.00
R8973:Krt13 UTSW 11 100,010,264 (GRCm39) missense possibly damaging 0.83
R9610:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9611:Krt13 UTSW 11 100,012,318 (GRCm39) missense probably benign 0.18
R9746:Krt13 UTSW 11 100,011,987 (GRCm39) missense possibly damaging 0.90
X0013:Krt13 UTSW 11 100,010,174 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCAGTCACGAATCTTCACCTC -3'
(R):5'- GAACACTGCTCCCTCTGAATCATCC -3'

Sequencing Primer
(F):5'- tccgaagtcaccaaagcc -3'
(R):5'- CCCACCCTAGAGAGTAGAGG -3'
Posted On 2013-04-11