Incidental Mutation 'R0092:Nmt1'
ID 20308
Institutional Source Beutler Lab
Gene Symbol Nmt1
Ensembl Gene ENSMUSG00000020936
Gene Name N-myristoyltransferase 1
Synonyms
MMRRC Submission 038379-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0092 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 102919163-102959734 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102937319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 119 (F119L)
Ref Sequence ENSEMBL: ENSMUSP00000021314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314]
AlphaFold O70310
Predicted Effect probably damaging
Transcript: ENSMUST00000021314
AA Change: F119L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: F119L

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.9441 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 T A 6: 58,662,762 (GRCm39) S535T probably benign Het
Acad11 A T 9: 103,967,540 (GRCm39) probably benign Het
Acadm A T 3: 153,647,512 (GRCm39) probably benign Het
Acot12 T A 13: 91,889,684 (GRCm39) M12K probably damaging Het
Actr2 A T 11: 20,044,308 (GRCm39) N99K probably benign Het
Adam2 G A 14: 66,291,336 (GRCm39) A314V probably damaging Het
Agl C T 3: 116,587,453 (GRCm39) R34Q probably damaging Het
Agrn C T 4: 156,263,410 (GRCm39) R338H probably damaging Het
AI661453 A G 17: 47,778,440 (GRCm39) probably benign Het
Alpk3 A G 7: 80,742,301 (GRCm39) D706G probably benign Het
Apbb1 T C 7: 105,208,361 (GRCm39) E648G probably damaging Het
Astn2 C A 4: 66,322,219 (GRCm39) A127S unknown Het
Asxl2 T C 12: 3,546,313 (GRCm39) S366P probably benign Het
Bdh1 A T 16: 31,266,380 (GRCm39) K92* probably null Het
Bltp1 A G 3: 37,082,308 (GRCm39) D3790G probably benign Het
Cacna1g C T 11: 94,348,090 (GRCm39) S666N probably damaging Het
Ces2b A G 8: 105,563,144 (GRCm39) T361A possibly damaging Het
Col6a4 T A 9: 105,890,513 (GRCm39) E1927V probably benign Het
Ctnnb1 T G 9: 120,781,929 (GRCm39) I314S possibly damaging Het
Cyp2c66 T C 19: 39,172,224 (GRCm39) probably benign Het
Dennd4c T A 4: 86,699,844 (GRCm39) F232I probably damaging Het
Dennd5a T C 7: 109,499,013 (GRCm39) N950S possibly damaging Het
Dhx30 T C 9: 109,914,078 (GRCm39) N14S possibly damaging Het
Dip2b T A 15: 100,100,146 (GRCm39) V1004D probably damaging Het
Dnah1 A C 14: 30,993,566 (GRCm39) S2872A probably benign Het
Dnajc10 T C 2: 80,156,026 (GRCm39) V233A probably damaging Het
E230025N22Rik A G 18: 36,822,277 (GRCm39) L162P probably damaging Het
Elmod3 T C 6: 72,543,792 (GRCm39) D333G probably benign Het
Epb41l3 T A 17: 69,593,745 (GRCm39) M846K probably damaging Het
Frem2 A G 3: 53,497,217 (GRCm39) Y1766H probably benign Het
Fxr2 T C 11: 69,532,972 (GRCm39) probably benign Het
Gmpr2 A G 14: 55,915,402 (GRCm39) R258G probably benign Het
Helb T C 10: 119,925,713 (GRCm39) Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,001,899 (GRCm39) probably null Het
Hipk2 T C 6: 38,720,164 (GRCm39) D482G probably damaging Het
Itgb4 G T 11: 115,869,950 (GRCm39) R44L probably damaging Het
Itih1 T C 14: 30,662,820 (GRCm39) probably benign Het
Kit T A 5: 75,808,414 (GRCm39) S719R possibly damaging Het
Krt13 G A 11: 100,012,258 (GRCm39) Q22* probably null Het
L3mbtl4 A C 17: 68,732,698 (GRCm39) R59S probably benign Het
Lpp A G 16: 24,580,352 (GRCm39) S23G probably benign Het
Magi3 G A 3: 103,958,280 (GRCm39) Q602* probably null Het
Man2a1 A G 17: 64,966,079 (GRCm39) probably benign Het
Muc5ac A G 7: 141,372,367 (GRCm39) E2667G possibly damaging Het
Myef2l G A 3: 10,153,633 (GRCm39) C134Y possibly damaging Het
Myo15b C G 11: 115,753,812 (GRCm39) S842C possibly damaging Het
Naf1 T A 8: 67,341,760 (GRCm39) S462T probably benign Het
Necab3 T C 2: 154,400,659 (GRCm39) D34G possibly damaging Het
Nisch C A 14: 30,913,410 (GRCm39) probably benign Het
Nlrc5 T C 8: 95,216,222 (GRCm39) probably benign Het
Nod1 T G 6: 54,921,526 (GRCm39) D264A probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nt5e T A 9: 88,252,338 (GRCm39) F567I probably benign Het
Obscn A T 11: 58,942,073 (GRCm39) M4434K possibly damaging Het
Opa1 A T 16: 29,444,412 (GRCm39) D866V probably damaging Het
Or10a3m T C 7: 108,313,031 (GRCm39) V145A probably benign Het
Or10al3 T G 17: 38,011,696 (GRCm39) L45R probably damaging Het
Or10p1 A G 10: 129,444,090 (GRCm39) S87P probably damaging Het
Or1j21 A G 2: 36,683,508 (GRCm39) T87A probably benign Het
Or51ai2 T C 7: 103,586,934 (GRCm39) S116P probably damaging Het
Otop1 T A 5: 38,457,174 (GRCm39) V311E probably damaging Het
Pcsk2 A G 2: 143,642,944 (GRCm39) D407G probably damaging Het
Pdcd1 A G 1: 93,980,149 (GRCm39) W23R possibly damaging Het
Pigp A G 16: 94,166,321 (GRCm39) V129A probably damaging Het
Pik3r5 A G 11: 68,383,629 (GRCm39) R483G probably benign Het
Pink1 A G 4: 138,047,309 (GRCm39) V225A probably benign Het
Plcl1 C G 1: 55,735,924 (GRCm39) Q422E probably damaging Het
Plec T C 15: 76,067,943 (GRCm39) E1222G probably benign Het
Polr1a T C 6: 71,944,439 (GRCm39) probably benign Het
Prokr2 C T 2: 132,215,517 (GRCm39) V154M probably damaging Het
Rasgrp4 A G 7: 28,844,557 (GRCm39) R280G possibly damaging Het
Rmnd5b T C 11: 51,520,419 (GRCm39) E8G possibly damaging Het
Sbf2 T A 7: 109,920,013 (GRCm39) probably benign Het
Sec23b A G 2: 144,408,830 (GRCm39) M172V probably benign Het
Setx T C 2: 29,036,305 (GRCm39) V930A probably benign Het
Sft2d2 G A 1: 165,006,829 (GRCm39) A159V possibly damaging Het
Sh3gl1 G T 17: 56,325,088 (GRCm39) R250S probably benign Het
Skor1 C A 9: 63,053,277 (GRCm39) D231Y probably damaging Het
Slc24a1 T G 9: 64,856,034 (GRCm39) E291A unknown Het
Slc28a2b G T 2: 122,348,078 (GRCm39) probably benign Het
Smc1b A T 15: 84,951,925 (GRCm39) probably benign Het
Tbccd1 A T 16: 22,644,844 (GRCm39) N177K possibly damaging Het
Tdp1 T A 12: 99,921,248 (GRCm39) Y595N probably damaging Het
Tle5 G A 10: 81,397,054 (GRCm39) G10D possibly damaging Het
Tmem108 T C 9: 103,366,504 (GRCm39) K496E possibly damaging Het
Tmprss7 T C 16: 45,487,959 (GRCm39) D490G probably damaging Het
Tnrc6b A T 15: 80,802,729 (GRCm39) N1511Y probably damaging Het
Top2b G A 14: 16,409,263 (GRCm38) R802Q probably damaging Het
Trip10 A T 17: 57,557,798 (GRCm39) K27N possibly damaging Het
Txlnb A G 10: 17,718,503 (GRCm39) N445D possibly damaging Het
Txnrd1 T A 10: 82,715,636 (GRCm39) I159N probably damaging Het
Ulk1 C A 5: 110,944,193 (GRCm39) A164S probably null Het
Vmn2r83 T C 10: 79,327,798 (GRCm39) V802A probably damaging Het
Zbtb4 A G 11: 69,670,177 (GRCm39) I967V probably benign Het
Other mutations in Nmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Nmt1 APN 11 102,950,902 (GRCm39) critical splice acceptor site probably null
IGL02058:Nmt1 APN 11 102,943,116 (GRCm39) missense probably benign 0.00
IGL02582:Nmt1 APN 11 102,955,625 (GRCm39) missense possibly damaging 0.94
cropped UTSW 11 102,947,285 (GRCm39) missense probably damaging 1.00
R1401:Nmt1 UTSW 11 102,948,307 (GRCm39) missense probably damaging 0.99
R1827:Nmt1 UTSW 11 102,955,664 (GRCm39) missense probably damaging 1.00
R1878:Nmt1 UTSW 11 102,943,077 (GRCm39) missense probably benign
R2199:Nmt1 UTSW 11 102,954,682 (GRCm39) missense probably damaging 1.00
R3930:Nmt1 UTSW 11 102,943,059 (GRCm39) missense probably benign 0.37
R4373:Nmt1 UTSW 11 102,934,026 (GRCm39) missense probably damaging 0.99
R4648:Nmt1 UTSW 11 102,954,743 (GRCm39) missense probably damaging 1.00
R5666:Nmt1 UTSW 11 102,949,041 (GRCm39) nonsense probably null
R6908:Nmt1 UTSW 11 102,949,080 (GRCm39) missense possibly damaging 0.92
R7315:Nmt1 UTSW 11 102,951,009 (GRCm39) missense probably benign
R7473:Nmt1 UTSW 11 102,937,226 (GRCm39) missense probably benign 0.05
R7504:Nmt1 UTSW 11 102,947,285 (GRCm39) missense probably damaging 1.00
R8548:Nmt1 UTSW 11 102,934,052 (GRCm39) missense possibly damaging 0.80
R8913:Nmt1 UTSW 11 102,948,271 (GRCm39) missense probably damaging 1.00
X0018:Nmt1 UTSW 11 102,919,412 (GRCm39) missense probably benign 0.01
Z1177:Nmt1 UTSW 11 102,946,039 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CGTCAAGCCTCGCTAACACAATGG -3'
(R):5'- TAAGCACGCATCACTGAGGGGAAC -3'

Sequencing Primer
(F):5'- GCTAACACAATGGGCCTTTTC -3'
(R):5'- CAGCCTGTCACTAATTTAAGAGGG -3'
Posted On 2013-04-11